SimpleSearch - Line and FST details


Line specific information

 
Line ID 349G01
Vector Used pAC161
Line Availability only available from NASC (N433481)
Segregation Analysis 100:100:73
Confirmed for Hit At1g64670
Parent of DUPLO pair none
Parent of pair(s) 3225, 3325

Gene hit At1g64670

 
Sequence (A. th genome BLAST matches underlined)
>07-K016248-022-349-G01-8409
GATCATGAGATTTCCCGGACATGAGCCATTACAATTGAATATATCCTGAAACATCCCCAT
GCACTTTTGTCTATTCCATGGAAGAATCAACAGATCTTTGAAGGCATTTCTTTAAAGTAA
TGCTTAATCCTATGGGCATCTCACCTATAATGAGATTTACATTATATTGCTTGTTCAAAA
AACAAAAAAACAAATATNTGCTTGTGCTACACTATGGGATCCTCCNCTATAGTGAGANNC
NNNNNNNCNCNNGNNCNNCNNCNCNNCNNNCCCCCCCCCCCCCCCCCCNNCACNCCCCCC
AACCCCCCCCAACCACCCCACCNAACAAACACCCCCCAACCCAACACACAACCCCCCCCC
CACCCAAACAGAACATCTACCCCCCACAAACCACACAAACAACCACCCCGAAACCCCACC
CAGCCCAACCTTCACACANTTCAAACCCCCCCCGGAGCTCCAGAAAACGGACACGCGTAT
CCGCGCACACCACTCAACCCACGATGAATACCACCCGCCCCATAATCCAACCCCAAAACC
GCTATCCATTTCCCACATTCCCCCATAATACCCCCCACCGCCGACACCAAAACACCACAT
AATACCCCGCGCAAGGTCGTATAACCCCACACCCCCCCCCCGCCCTTGACAAATGTTCCC
GACCCACAACCCCTACATCACAAAATGTCCTTCGCGTTCACCCCCCCACCCGAGCACATA
TATAAACATACCCCGCAAACACGACGCCCANCGTAATAACGATACCACAAATCACACATT
GTCGCTATATACCCCATATAACACCCTCCACCCCCCGCCACGCCCACCGCTACATACCCA
CATAGATCCCAAACACAAAAGACACCACACTAACGCCCCTAACACACAAGAACCCCCCAA
AACAAAGCCCTCTCTCACGGACCGCGCTCCGCGAAACGGCACGTAAAGAAGAAACACCAC
ACAAAA
GenBank Accession BX890995 [GenBank]
Graphic View Graphic view of gene At1g64670
Predicted Position of Insertion Chr1:24032507 - go to primer design
BLAST e Value 2e-33
Hit Clone Code (BAC ID) F1N19
Hit Gene Code At1g64670 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation alpha/beta-Hydrolases superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX890995 [GenBank]


Last Updated on 31.08.2016 09:40