SimpleSearch - Line and FST details


Line specific information

 
Line ID 349G01
Vector Used pAC161
Line Availability only available from NASC (N433481)
Segregation Analysis 100:100:73
Confirmed for Hit At1g64670
Parent of DUPLO pair none
Parent of pair(s) 3225, 3325

Gene hit At1g64670

 
Sequence (A. th genome BLAST matches underlined)
>07-K016244-022-349-G01-8409
CATTCAGATACTATGTGGAACAACTTATGACACAATGCACACCTAATGGGGAGAGACAAG
ACTTATACTCAGAAGTTGAGTGAAAAAATCGCTTAATACTTTATCCATATTACATCATAA
ATTATTTACATTATATTGCTTGTTCAAAAAACAAAAAAACAAATATTGCTTGTGCTACGC
TATGGGATCCTCCCCTATAGTGAGGACATGCTCCCCCCAT
GenBank Accession BX890994 [GenBank]
Graphic View Graphic view of gene At1g64670
Predicted Position of Insertion Chr1:24032487 - go to primer design
BLAST e Value 1e-40
Hit Clone Code (BAC ID) F1N19
Hit Gene Code At1g64670 [TAIR] [MIPS] [SIGnAL]
Gene Annotation alpha/beta-Hydrolases superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23