SimpleSearch - Line and FST details


Line specific information

 
Line ID 350C10
Vector Used pAC161
Line Availability only available from NASC (N433538)
Segregation Analysis 100:99:72
Confirmed for Hit At2g23290
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g23290

 
Sequence (A. th genome BLAST matches underlined)
>75-K016249-022-350-C10-8409
TATCCTGAAATTTCCCGGACTGAAGCCATTTACATGAGTACACTATATACATGTAGATTT
CTTCGGTTCAAGTTCTTTTCGCGTTTTAAACGATTTGATTAGTTTTAAATTAAAAAGAAG
ATCCGAGCGATGTCTGGTTCGACCCGGAAAGAAATGGATCGGATCAAAGGACCATGGAGT
CCTGAAGAAGACGATCTGTTACAATCGTTGGTTCAGAAGCACGGACCAAGGAACTGGTCT
CTGATAAGCAAATCAATCCCTGGACGTTCCGGTAAATCTTGCCGTCTCCGTTGGGGTAAT
CAGCTTTCTCCGGAGGTAGAGCACCGTGGATTCACAGCGGAGGAAGATGATACGATGATA
CTATGGGACCTGCNTTATANGGAAGACTGAGACACCTTGCTTTTCCGCAATCTAAGCAGT
AAACCGACATATCGCTGTGTTAAGGAATCTCAAGAGGTCTTTGGGCATCACCCTGTGTTG
CATAGACATTATTGCCCTATGCACTTCTGACATGGTATCCCTGATATACGAGGAGTATCT
GACCGTGACTTGCTCCAACAAGATCCCGAATGAACTGTTCTTGACGCTGAACCGCAAGAT
ACTCTGGATCAACTGTTCGAAACTCTGACCGCGAGTTATGGTGGGTCCTCTATGTGATCT
TGGGACTCATGGGAATTGGGGAATCTCTAG
GenBank Accession AL953324 [GenBank]
Graphic View Graphic view of gene At2g23290
Predicted Position of Insertion Chr2:9905895 - go to primer design
BLAST e Value 4e-152
Hit Clone Code (BAC ID) T20D16
Hit Gene Code At2g23290 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation myb domain protein 70
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit T3A4

 
Sequence (A. th genome BLAST matches underlined)
>75-K016245-022-350-C10-8409
TTTCCCGGACTGAAGCCTTTACATTGAATATATCATTGGTAATTTGACTAATTTACTCGG
ATTAGCACTTACTTAAAATTTCAACCCTTTTTCTTGAGTCCCAACCCATTATTAACTGTT
GGTCGTCATTACTCTTTAATTCTCAGTTGCTGACCACATACTTTCTTAAAACTATTTGTT
GACGAGTAATTAAAACAATTTATGAGTATCTTTTACTTCATAAAAAATATTAAAAGGACA
ACTATATTAGGAAATATAAAAGAATATTAGTTATAAACTTACTGTCATATTGATATATAG
CTATGCAAACAATAGAAAATACATTCAGCATTCATTGGGTTTCTTAATTTAAGTGTTCTA
TATTTTTGGTAGGTCTCTTACCAATAGAATAACGTTAACAATATTTTTAATAAAAACATA
TACAGATATTTCTAAAGTCTTACACTTCATTATTTAGCATAATGTGTTGTTTTATATATT
TGTAATATAAAAAAGTGCTACTCGATAGAGTTTCTCTTTAAATATTTTAGTTGATAATCC
TTGAATTTTTCTTACTTATTGCTAATATTTTTGGTCAAATCTTAATTATTGCTATGG
GenBank Accession AL953323 [GenBank]
Graphic View Graphic view of sequence AL953323 of line 350C10
Predicted Position of Insertion Chr2:19179914 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T3A4
Insertion Classification Genome Hit
Confirmation Status unknown


Last Updated on 31.08.2016 09:40