SimpleSearch - Line and FST details


Line specific information

 
Line ID 351G01
Vector Used pAC161
Line Availability only available from NASC (N433673)
Segregation Analysis 50:48:45
Confirmed for Hit At3g12100
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit T13K14

 
Sequence (A. th genome BLAST matches underlined)
>07-K016246-022-351-G01-8409
TGATCATGAGATTTCCCGGACTGAAGCCATTACGAGTTGAATATATCCTCGGAATAACTA
GTACACTGGATCAATTGATCATATTTTCAGATATATCCACATGACATAGACTAGCATCTG
GTCTTTAGCGCATTTCAGATTAGTCTGACAGATCACAGACCTCACATACCGTATAAGAAA
ATAGTTAATTACAAATCGAATGTGGTAGTCCTAACTTTATCAAATAAGTTATGCTATTGC
TCAGTCTAATCATATAGGAACAAAGTGTGATCAACTGATCAATCTCTATGGGATCCTCCC
TTATAGTGAG
GenBank Accession AL953501 [GenBank]
Graphic View Graphic view of sequence AL953501 of line 351G01
Predicted Position of Insertion Chr4:11170973 - go to primer design
BLAST e Value 1e-77
Hit Clone Code (BAC ID) T13K14
Insertion Classification Genome Hit
Confirmation Status unknown

Gene hit At3g12100

 
Sequence (A. th genome BLAST matches underlined)
>07-K016250-022-351-G01-8409
TTTCCCGGACTGAAGCCATTTTTATTATATCTCTGCTTGAAAAACTGCAACATGGACAAC
TTCATGTTGACTGTATATAAATTTGATGGACAAGGAAGCATTTTCTTTTCTATATATCTT
TCTCCGATGACTGCTTGAAATTTATACATGCAGAGAGGATTAACACCTGCGGATGGAATC
TGATATGACGTGCAAGCTAACGGAGTGATAATTCGTATCTGCTGCTTTTCTGCAGGCTGC
AACATATTGCATATTATGAATATAACAAAAAATTCTAGAAACCATGTGGATTTTAGATAT
GTAAAGAAGGGACAGATAATTTCAAGAAGCAACGAATAGTCGTTTGACAGATCAGTTACA
ATTATGCTGACTCTCTCTTTCAACTAATCTTCGTACTGATTCTATCTTAACCAAACACCC
TTACTTCTTTGGCTTTAAAGCGAAAACTGACAAGGGTGGCCAATTTCTACAAATGAATAC
CAAAGCCACCAACAAAGGCTATATCAAAATATAAAGCAGCGTATGAGCATCAATTCATAC
AAGTCTAAACAGAACTTAAAATGCAGAGAAAAACATACCAATATTGACACGAGCATAATT
CCGGAAAAACCAAACACCTAT
GenBank Accession AL953502 [GenBank]
Graphic View Graphic view of gene At3g12100
Predicted Position of Insertion Chr3:3855415 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T21B14
Hit Gene Code At3g12100 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Cation efflux family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03