SimpleSearch - Line and FST details


Line specific information

 
Line ID 352F03
Vector Used pAC161
Line Availability only available from NASC (N433759)
Segregation Analysis 50:44:42
Confirmed for Hit At3g13920
Parent of DUPLO pair none
Parent of pair(s) 3885, 4125, 7203, 9878

Gene hit At4g33410

 
Sequence (A. th genome BLAST matches underlined)
>22-K016360-022-352-F03-8409
TCGACATTGAGTCATTGAGTGTAATACCTGCTTAATTTTGGATTTCTGGGATTGTTATTA
GAATGTAGAGCACACTTGGATAACTGAGTTTCCTTAAGCTGTCAATCTGGGTATAAACAA
TTTTAAATTTACCCTTTTTCTTAAAGAACTCATCTTTAGCTTGAGGTCTGAATTTTTGAG
CCGAACATGTACTTAGTATCTTATTAACCATGTCTTGAGAACTATTATCTTTCTTGATGT
CCCTTTGTTCTGAACAGATCTCAAGAACGTTAATCTTTTTGGTTATACTGGCGGCTTACA
CTGAGGTTTGATGCTGTGAGTTTTTATTTTACCGGCTCGCATCTGATGTAAACTGATTGC
AACTCCTACAGGGATTTCGCATATTTGCTTTTATGCGTACGACGCTGTGGGGGATGTTTA
TATAATCGGACATAACTCTTTTCTTATCATGGAGACTCTG
GenBank Accession AL953609 [GenBank]
Graphic View Graphic view of gene At4g33410
Predicted Position of Insertion Chr4:16081198 - go to primer design
BLAST e Value 7e-129
Hit Clone Code (BAC ID) F17M5
Hit Gene Code At4g33410 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation SIGNAL PEPTIDE PEPTIDASE-LIKE 1
Insertion Classification TS2TE (5')
Confirmation Status unknown

Gene hit At3g13920

 
Sequence (A. th genome BLAST matches underlined)
>22-K016361-022-352-F03-8409
TGTCCTGAAATTTCCCGGACTGAAGCCATTTACATTGATATTAAGGAAGTATCTCGTCCG
CGCGCATATAGTGTAGTCGAAGACTCCATGGAATACTCGCGTATTGTAAGAAACTCTATG
GGATCCTCCCCTATTATGAGACTGGTGGGGTGACGGACCTATGGGATCCTCCCTATAGTG
AGAAGTGAGATTCAAGTTAAACTATAACGAGAATGGAATTGAAACACTGAGAAATATTTG
CATACCTGGTCCTTGAAACCACGGGAGAGCATTTCATCAGCTTCATCAAGAACAAACATC
TTGATGTTGACAGCACGAAGAGACTGCCTCTTCAACATGTCAAAGACACGCCCTGGAGTT
CCAACAACAACATGGACACCAGCTTGGAGGATGCGCTGATCCTCACGGACACTGGTTCCA
CCAACACAGGCGTGAACCTTGACACCAAGGTAATCACCAAGGGCCCTCATGACCTTCTCA
ATTTGCTGAGCAAGCTCACTATGGGATCCCCCCAATAGCGAGAGATCTTCTTTGAAGAGC
TCCGGATTCAAATCCGAGTCGGGTCAATACCGGCGGGTCGTTCGGTAATCTTGAGCCTTT
CAGAGCTTCACGTCATCTTCCAGAAACTCAAGTTCCTACTATGGG
GenBank Accession AL953610 [GenBank]
Graphic View Graphic view of gene At3g13920
Predicted Position of Insertion Chr3:4593165 - go to primer design
BLAST e Value 2e-172
Hit Clone Code (BAC ID) MDC16
Hit Gene Code At3g13920 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation eukaryotic translation initiation factor 4A1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03