SimpleSearch - Line and FST details


Line specific information

 
Line ID 354E09
Vector Used pAC161
Line Availability only available from NASC (N433945)
Segregation Analysis 100:100:81
Confirmed for Hit At4g08980
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g37475

 
Sequence (A. th genome BLAST matches underlined)
>69-K016365-022-354-E09-8409
TGTCCTGAAATTTCCCGGACATGAAGCCATTTACATTGACCTATGGGATCCTCCCTATAG
TGAGACCACTAAGCCAAAACCTACGGCATTCTCCCTATACAGAGATTCATTTGCTATAGC
TGTAATGGACGAAGCAACGTCTTTAACATCTGCTGCTTTCATATTAGCCACAGAAAGTCT
CATCACTGCTTTGAGTAGCCCGATATAGTGAAAGCTTTTCTGCGAAATAGTAGACATAGT
TAAAATGCAGACGAATTGGTCTTAATATGATATTTGGTCATATAGAAATAAGTGACAGTT
AGCTAAGACAAGAAAGTAACAGGAAATGAAAATAGCATACCTCAAATGGTACAAGTCTCT
GAGATATCAACTCAGCATAATCCAAGAAATCGCTTTCAGACTTCGGAATTAACATATCGA
CGCTTTTCTCTTCAGTCTTTACTCCAAAGAGTTCAGCAGTTGATTGGTAATCAGCTTCCT
CTACAAGCCTAAGATAAGAAGAATATTAAAAATTAGCACAATGGCCTTCCTCAGTGACAT
GCTTCTTACACTACTATGGGATC
GenBank Accession AL953785 [GenBank]
Graphic View Graphic view of gene At5g37475
Predicted Position of Insertion Chr5:14866620 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T25O11
Hit Gene Code At5g37475 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Translation initiation factor eIF3 subunit
Insertion Classification CDSi
Confirmation Status unknown

Gene hit At4g08980

 
Sequence (A. th genome BLAST matches underlined)
>69-K016364-022-354-E09-8409
ACAAAACCAGAAAGCATGTAAAATATTAGATACAAAAGCAATGAACTAAGAAATCATGTT
GCTTCAATCACATCCCCTAATACATTCTATGCCTATAACCACTTAAAAAGCTTAATTCTA
AATATGATCATAATACATTAAACTATAGCAACTTACTGTTGTGCAATGAAGGAGAANATA
GAGTCATTTCGAAAGCCAGTAACGGAGAGTTTTCGCAA
GenBank Accession AL953784 [GenBank]
Graphic View Graphic view of gene At4g08980
Predicted Position of Insertion Chr4:5759987 - go to primer design
BLAST e Value 2e-101
Hit Clone Code (BAC ID) T3H13
Hit Gene Code At4g08980 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation F-BOX WITH WD-40 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03