SimpleSearch - Line and FST details


Line specific information

 
Line ID 355A07
Vector Used pAC161
Line Availability only available from NASC (N433991)
Segregation Analysis 50:49:30
Confirmed for Hit At1g12600
Parent of DUPLO pair 1610
Parent of pair(s) none

Gene hit At1g12600

 
Sequence (A. th genome BLAST matches underlined)
>49-K016831-022-355-A07-8409
CCATGTTACATTGATTAATCTTTGTCGCGTAATGTATCAGGTGTAGATGGAGAATATGTC
AACCGGTCTCCGTTGTTGCTATGGGATCTTCCCTATAGTGAGAGCAACGGTTTATAGTAC
CTAATCCATGTGAGACCCCACCCATTCTGACATTGTCATAATGTAATGAGTCTCTGATTA
CAAATCCGACATTAACAAATGCAATGATCTATATATATTGAACGAAATTGATCTCTCACA
TTAATTGTGAATATTCAAATGATGACCATCATACTCATTGCTGAAAGGATATATTCTATT
GTAAATGGCTCCATGTCCGGGAAACCTACATGGATCTCTATTGAATATGATGGACAATAT
GGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCCACC
CGTTATTATAAANNNN
GenBank Accession BX001307 [GenBank]
Graphic View Graphic view of gene At1g12600
Predicted Position of Insertion Chr1:4287634 - go to primer design
BLAST e Value 3e-26
Hit Clone Code (BAC ID) T12C24
Hit Gene Code At1g12600 [TAIR] [MIPS] [SIGnAL]
Gene Annotation UDP-N-acetylglucosamine (UAA) transporter family
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23