SimpleSearch - Line and FST details


Line specific information

 
Line ID 355H10
Vector Used pAC161
Line Availability only available from NASC (N434078)
Segregation Analysis 50:50:48
Confirmed for Hit At4g10180
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g10180

 
Sequence (A. th genome BLAST matches underlined)
>80-K016870-022-355-H10-8409
TGATCTGAAATTTCCCGGACATGAAGCCATTTACATATGAAGCCATTTTCAATTGTAATT
GTTGGTCTTCTGGGCCAACAAATGTTCACAAGCGGTAACGTCACCGCTCGGGTCTTCGAA
CGTCAGATTCGAACTCCTCCTCCCGGCGCTTCCGTCAGTCCCCAAATCTCTCTCTCTGTC
TCAATCTCTCAATCTCAATCTCTCTTTTGCTTATCTCTTTACCTTCAATGATAGGTAAAT
CGTGCAAGACACTTCTACGAAAACCTATGGGATCCTCNCCTTATAGTGAG
GenBank Accession BX001420 [GenBank]
Graphic View Graphic view of gene At4g10180
Predicted Position of Insertion Chr4:6346520 - go to primer design
BLAST e Value 3e-48
Hit Clone Code (BAC ID) F28M11
Hit Gene Code At4g10180 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation light-mediated development protein 1 / deetiolated1 (DET1)
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit K1L20

 
Sequence (A. th genome BLAST matches underlined)
>80-K016831-022-355-H10-8409
TGATCATGAGATTTCCCGGACTGAAGCCATTTACTTCTGACCAATTGTGGTTAAGTTATA
GTCAACCATTTTGGCCGTCAAAGAAGGCCTCTTCCTCAATTAGTCGCGTATGTTTTAAGC
AAAAAACGATTATTACTAATTTACTATAACTATGAAATTAAAAATAAACTTATACCATTT
TGGGTTTGACGCTATGGGATCTCCCNTTATAGTGAGANNNNNNNNNNNNNNNGNNNNGNN
NTNCNNGNNNNANNCNTNNANGAAGANCNANNNNNNNNNNNNNNANNGNNNNNNNGGGNN
NNNNGNNNGNNGGGGNNGGNGNNGNGGGGGGGGGGGNGNGGNGGAGGNGGGNNNGGGNNG
GGGGGGGGGGGGGGGTATTTTGGGAANAAGGAGAGGGATGGAGTATGATGAAGTTTNTGT
GAGAATAAATGTATGTGATGAGAAGTAAAGAATGTTTTGGATGGTGAAGAGGGTGAAANT
ATATTGATGGAGGAGAGGAGAGGGTGGAGGTGATAATAGAAGATGATTGAATATTTT
GenBank Accession BX001419 [GenBank]
Graphic View Graphic view of sequence BX001419 of line 355H10
Predicted Position of Insertion Chr5:26495381 - go to primer design
BLAST e Value 2e-76
Hit Clone Code (BAC ID) K1L20
Insertion Classification Genome Hit
Confirmation Status unknown


Last Updated on 07.07.2016 14:03