SimpleSearch - Line and FST details


Line specific information

 
Line ID 358H06
Vector Used pAC161
Line Availability only available from NASC (N434362)
Segregation Analysis 50:47:32
Confirmed for Hit At4g03290
Parent of DUPLO pair none
Parent of pair(s) 3814, 8310, 11185

Gene hit At4g03290

 
Sequence (A. th genome BLAST matches underlined)
>48-K016873-022-358-H06-8409
TGATCTGAAATTTCCCGGACTGAAGCCATTTACATTGACATGAAGTAATGTCAGCGTTGA
CCTTCTTAGCTGGGAATCCAGTCATGGATGTGAGACCGCAAGAGAAAATGGCTATTCAAA
TAACCAAAAGTAAAAACAAGAGAAGGTAAAAAAAGAAGAAAAAAAGTGATTATCAGCTCA
AAGAGCTAAAAAAGCGACCCTTTTTCATCATTTGTCTAAACTCCATGTAATTAACCCTAC
CATCACCATCAACATCCACTTGCATTATCATCTTCCTACATTCCTCCAAGGTCTTACCTT
GCTTGAGTCCCAAGGAAGATAAAACCGCTTTCAATTCATCCACCGTTATAAACCCATCTC
CGTTCCGATCAAATACGTTGAACGCTTCCTTCATATCTTCTTCTCCTACCTCGTCCTCAT
CTTCTACCATTATCGTCTTGTAGAGCTCTCCAAACTCTTCAATGTCAACACAACCGTCAC
CATTAACATCGATCTTTTGGATAATTTGTGTTAGTTCGTCTTCGGGTATTATGATACCGA
GGTTCTTGAATGACTCGTTCAGCTCCTTCGTAGTGATCTTCCCGTCTCCGTCCTTGTCGA
ACATTTGGAACACACGGTTCAGCTCCGTGGAATCCATTTGTTTTAATAAATTTAGGGCTT
TTTGGAGGTTGCGTGTGGAGGAAGCAAATGTGAAAAAAGAGAAGATGAGACTCCTATGGC
TCCCCCC
GenBank Accession BX001792 [GenBank]
Graphic View Graphic view of gene At4g03290
Predicted Position of Insertion Chr4:1443255 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F4C21
Hit Gene Code At4g03290 [TAIR] [MIPS] [SIGnAL]
Gene Annotation EF hand calcium-binding protein family
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At5g11100

 
Sequence (A. th genome BLAST matches underlined)
>48-K016835-022-358-H06-8409
TGTAAATTTCCGGACATGAGCATTTACATTGATATATCCTGAGAAACAATATGGCATTTA
CTCCGGGTTCTTGCCTTCTGTGATCTCGCGGGACATCCAATCAGCTATGGGATCTGCCCT
ATAGTGAGAGCGTGAACAAAAATGGGTTTTCTCTTTGGTTTGATCATAGGAATCGCGGTT
TCTTTCGGTTTGGTCGGCGCATTTGCTCGCTACTCTATGGGATCCTCCCTATAGTGAGAA
GAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGT
TATAATAAAATATTAAGTCTTACAGTTCACCTCCGCGGTGAATACCAAAGATCCACTTTT
TATTTTTTTCCTTCGTCCCCTCTGGGACGGTCCAATATTTTGTAGGGCGAACGCGATCAT
GAATAATGGATACAAATGCTTAGATCTGATGGCTCTATCATAGGCTACTCCACCTGCCAC
TATTATCATCGATCATTCTGGACTAGTTAGAGAAGAGATTGACCTTCATTCGAGTTAAAA
ACAGGAGGTACTTGCATGCCTGCATTCGGAACCACCCCTGTGATGAGCTGCGGCACCGGG
CCCTATCTGCGGGTTTTGCAAAAGATGTATAATGGCAGATGTAAACCCCCTCGTTTTTTG
ATGGTTCGCGACTTGCTTGCAAGCTAAACTGAAGAAAAGTGGTTAAA
GenBank Accession BX001791 [GenBank]
Graphic View Graphic view of gene At5g11100
Predicted Position of Insertion Chr5:3532314 - go to primer design
BLAST e Value 2e-36
Hit Clone Code (BAC ID) T5K6
Hit Gene Code At5g11100 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Calcium-dependent lipid-binding (CaLB domain) family protein
Insertion Classification 5' region
Confirmation Status unknown


Last Updated on 14.10.2014 10:23