SimpleSearch - Line and FST details


Line specific information

 
Line ID 358H08
Vector Used pAC161
Line Availability only available from NASC (N434364)
Segregation Analysis 50:49:35
Confirmed for Hit At2g41040
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit F5F19

 
Sequence (A. th genome BLAST matches underlined)
>64-K016873-022-358-H08-8409
TGTCATGTAATTTCCCGGACTGAAGCCATTTAAATTGAATATATCCTATTCTAATATTTT
CACCTTTAACCGAGACTAAACTCTTTTTCTCTCTCTCTTCCTCAAATAAACTACTTTTAA
TCTTTGTCTTCAGCTTAAGAATTATAACAATTATGAAAGACCTATGGGATCCTCCCTATA
GTGAGANAANANNNANNTTTTTTTCCCTATTTTTTTTCATTTCAAAGTGCAAATGCCCGC
ACCCTTTTTATAAACACNGGTGCATATATTCACACATCCCCAAAACTTGTAGATCCAATA
AGAGCAATCCACGGAAATACGAACGAACCAATTTCTAACCAAAAAAAAAGAGGAGGGAAT
TTTTTTGGTGTTTCCCCCCCCCCCCCCAAGAAAAAAATGGAAAAAAACGAAAGGGGGGAC
GGCAAAAAAAAAAAAAAAAAAAGCGGGGGGGGGGGGCGGGAAAAAGAGGGCCAAAAAAAA
AAAAAAAAAGAAGAGGGGCGGACAACGGCGGCGGAGGGGAACAAGGACCGCCCCGCACCC
ACCAACACAGAACGGGGCATTTATTTTACCTGCACACGAATCTATACGGATCGAACAACT
GGAGAAAACATAGACAAAAAGGAGAAACCCCAAAATAAGGACGGGAAAAATATTGGCAAA
TGCCCCGGCCCCGTGACTAAAAACCCGCACTTTATAGGCTGCCGGGATAAACGAATAAAA
GGGGGTAAGATCGAACGAAACACGGTATATTAGTAAAGCAGGAACCGCACAAATTAGAAC
AATCGTCTAAAACAATGATAAACACAATATAATAAAACCTGTATAAATT
GenBank Accession BX001795 [GenBank]
Graphic View Graphic view of sequence BX001795 of line 358H08
Predicted Position of Insertion Chr1:19403089 - go to primer design
BLAST e Value 2e-52
Hit Clone Code (BAC ID) F5F19
Insertion Classification Genome Hit
Confirmation Status unknown

Gene hit At2g41040

 
Sequence (A. th genome BLAST matches underlined)
>64-K016835-022-358-H08-8409
GAAGAATATTCATGGAATGTGCTTGACCTACATAGGAGAGAGCTACTTCTCTTGCGCTGT
GGGGCGTACTCGCACCAATGCTATGGGATCCTGCCGTATAAAGAGAAGAACTTACCGGTT
GATACCTGAAGGTCCTTTCCTCATAAGTGGTTCGTAGCAAACAGGACACGCGAACACTTG
AGTTTCCTCTATTTCGATCTTTGGAGTTTCATTTTTATTTATGTCCTGAAAATACCATTG
TACAAGGTTTACATACATATACAAAGCTTGTAAATCAAATCAAGTGAATTAACAAAAAAG
CAGAACGCACCGATTTGGGAGCAACGGCGCTTATGGCTGCGGATGGAAAACGAGAACGAA
CAGAGGTAGAAGCAGAGAATCGGAGAAGAGGAGATTGTGAATCAGAGGAGAAGAAGGAAG
AGCGGTTAGGTAAGAAAGGTTTGTTGAGGAGAGTAATAGCAGAAGAAGAAGATGTTAGAG
CCGCCATCGCCATTTGAGCAGAGAAATGGAGCTTAAAAATCAACGAGCACAGAGAGATGT
TTTGGCTCAATTTATACGAAATCTCGTTGCTCAGACAAATTGTGCGTTTCTTGTAACAGA
GTCTGGAGCAATAAATGTGTTGTCCGAATTTTGAGCTATGTTTTAAGCCGGAATAAAAGA
CGCACACTTCTCGTTTTCACCATTCACTTTTTCATCTATTTTTAAAAGTATATTATTACT
TGGGTAACAGGATCACATGATCGAGTGGATTCTTTGCTCAAAGTCACAACGTTGTACTGG
ACCTATGATCT
GenBank Accession BX001794 [GenBank]
Graphic View Graphic view of gene At2g41040
Predicted Position of Insertion Chr2:17121954 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T3K9
Hit Gene Code At2g41040 [TAIR] [MIPS] [SIGnAL]
Gene Annotation S-adenosyl-L-methionine-dependent methyltransferases superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23