SimpleSearch - Line and FST details


Line specific information

 
Line ID 360A04
Vector Used pAC161
Line Availability only available from NASC (N434468)
Segregation Analysis 100:86:79
Confirmed for Hit At4g01720
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g18930

 
Sequence (A. th genome BLAST matches underlined)
>25-K016878-022-360-A04-8409
AAAAAAAAAAATGGTTTGGTCTGTTTTTTTTTGGCCTTCCTTTAATTCCTTCTAAGGTTG
GTTTTTAAAATTTCCAATTAAAATAATCTAAAATCTAAAATTCAAACTGTGGAAAACCGG
TTTTAACCGTCCTAACTTAATAGGGTAACAAATCCATTCCCCTGAAAAGAAAACAATTTA
GAAGGGGAAAAATATTGAAAAACAATTCCAAAAAATCCTAACCAACGGTCCAAAATGTTT
GGCCGTAACCAAACATTTCCCAAGCCAAAATTACCCCCCCAAAAATATTGCCGGCCAACA
ACCTTTGAATTCCAAGTTAAAAATCCGTTAAAATTATAGTAAGAAACCCTCCCACCATCT
TTTACCTTTACACATTGGAAGAATTAAGGGCCGAACCATTTTGTGGCAAGGGAA
GenBank Accession BX001929 [GenBank]
Graphic View Graphic view of gene At5g18930
Predicted Position of Insertion Chr5:6311985 - go to primer design
BLAST e Value 3e-14
Hit Clone Code (BAC ID) F17K4
Hit Gene Code At5g18930 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Adenosylmethionine decarboxylase family protein
Insertion Classification TS2TE (3')
Confirmation Status unknown

Gene hit At4g01720

 
Sequence (A. th genome BLAST matches underlined)
>25-K016880-022-360-A04-8409
CCTTATTAAAGTTTTTCATCCAACAGATTTAGAAAGTTTTAAGAAGAGTATAGAAAATAA
TTCTAAATTTAGAAAGGCTGTACTAAATCCCTTACAAACAAAATCTTTTACTTATGAAAA
ACCAAAACTATGGGATCCTCCCTATAGTGAGAGGAAGAGAAAAAAAA
GenBank Accession BX001930 [GenBank]
Graphic View Graphic view of gene At4g01720
Predicted Position of Insertion Chr4:747318 - go to primer design
BLAST e Value 4e-53
Hit Clone Code (BAC ID) T15B16
Hit Gene Code At4g01720 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation WRKY family transcription factor
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40