SimpleSearch - Line and FST details


Line specific information

 
Line ID 360B08
Vector Used pAC161
Line Availability only available from NASC (N434484)
Segregation Analysis 44:31:19
Confirmed for Hit At3g25500
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g25500

 
Sequence (A. th genome BLAST matches underlined)
>58-K016880-022-360-B08-8409
ATCATACCTTCACCAGCAGAATCTTAGCTGGATTCATCACTCTATTCAAAAAGTTTCTCT
CTTCTCTTTTCTCAGATCTTGAACTCTTGAAGAAGAAAGAAGAAGATAACACAATGCTCT
TCTTCTTATTCTTCTTCTACTTACTCTTATCTTCATCCTCCGACCTATGGGATCCTCCCT
ATAGTGAG
GenBank Accession CR770352 [GenBank]
Graphic View Graphic view of gene At3g25500
Predicted Position of Insertion Chr3:9255008 - go to primer design
BLAST e Value 7e-55
Hit Clone Code (BAC ID) MWL2
Hit Gene Code At3g25500 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation formin homology 1
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40