SimpleSearch - Line and FST details


Line specific information

 
Line ID 360C11
Vector Used pAC161
Line Availability only available from NASC (N434499)
Segregation Analysis 69:64:58
Confirmed for Hit At4g26330
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g02965

 
Sequence (A. th genome BLAST matches underlined)
>83-K016880-022-360-C11-8409
GATCTGTNATTTCCCGGACATGAAGCCATTTACATTGAATATATCCTAGTAAGACATCTA
CATCGCCATTTCGCTCTGAGTTTACTTTCTCTTATTATTAGTAATGTGGGCTTTAGTAGG
CCCAATTCCCATGCTTTATATCCCACATTTCACAATTAATCACACATTAATCTGGCAATT
CCTTAATTTCACATCCTACGGGATCCTANCTATAGCGAGATCTATGGGATCCTCCCTATA
GTGAGAAACGGACATGCACATTGACCATCCAACCGTGAAGATAGCTCAGCGCGGACATAC
CGACTCCACAGTCTGGGAGATGCTCCGGCAATTGACTCGGCGGAGAAACCTGTCGTACAT
GTCGGCGAGAGTCTACCGAGAACGCAGCACGATCGCACCTGTGACCGACGAGGGATCACT
CTATGCGACTTGCTCTCTCTGCCTCCCTGGATATACGTGACAATGCGCGTCAGCACATCA
CCCTGAAGATTCGAGACGACNTCTGCTCCGACGACGATAGCTCCCTCGACTGAGGATATG
TTCTCTCCTCAGAGGAAGATACATACGTACATTTTTGACTTGACAAAAGACCAATCCCAT
GAACTTATGACAAAGCTCTC
GenBank Accession BX001963 [GenBank]
Graphic View Graphic view of gene At1g02965
Predicted Position of Insertion Chr1:672742 - go to primer design
BLAST e Value 2e-40
Hit Clone Code (BAC ID) F22D16
Hit Gene Code At1g02965 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation hypothetical protein
Insertion Classification CDSi
Confirmation Status unknown

Gene hit At4g26330

 
Sequence (A. th genome BLAST matches underlined)
>83-K016878-022-360-C11-8409
GATCATGAGATTTCCCGGACTGAAGCCATTTACATTGAATATATCCTGTTAGTCTCAACA
TCGGCCATGACCTGTAGCTTTACTTATTCTCATTACCATAATGAGGGATTTAGTCTGACC
ATTGACCTGCTAATTTTGATTTGACCCACATTAGAGCACTGATTAATCAGCGCAACTTAT
AATATATAGATTTAACGTGAGCCTAGCGAATGCGGGTGCTATGGGATCCTCGCCTATAGG
GAGAGACTTTGATCCATCTGTACATTGCAATCGTAAATTGATCGGAGCTCGATTTTACCT
CACAGGATTCGAAGAGACGTACGGAACAATTGACTTTACGCGAGATCCTGAATACCGATC
GCCGCGAGATTACCTCGGTCACGGCACACACACAGCTTCCACCGCCGTCGGATCCGTTGT
TCGCAATGTCTCCGGCTTCTTCGGTCTTGGACGCGGCACTGCTCGCGGCGGAGCTCCATT
GGCTATGGGATCTCCCCATCGCCGGAGAGGACGAAAGCTCCCTCACGTGAAAATATGTTA
TCTCATCAGTGAAGATACATACGTACATTTTTGACTTGACAAAAGACCAATCCATGAACT
TATGACAAGGCTCTCTTCGTCGCTA
GenBank Accession CR396449 [GenBank]
Graphic View Graphic view of gene At4g26330
Predicted Position of Insertion Chr4:13320877 - go to primer design
BLAST e Value 2e-129
Hit Clone Code (BAC ID) T25K17
Hit Gene Code At4g26330 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Subtilisin-like serine endopeptidase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40