SimpleSearch - Line and FST details


Line specific information

 
Line ID 362D05
Vector Used pAC161
Line Availability only available from NASC (N434697)
Segregation Analysis 100:77:64
Confirmed for Hit At3g19590
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g56230

 
Sequence (A. th genome BLAST matches underlined)
>36-K016994-022-362-D05-8409
TTTCCCGGACTGAAGCCTTTACAGTAGAATATTTTACTTTAGTTTTTTTTTCTATTTAAT
TGGTACTTTTGAAATTGTTTACATAGACATCAAACGCCATTGAATTCTTTATTTAAAGCC
CTAGTAAATTATTGTATTTTTAAAATCGTCGAACATCCTATTATAAAACTAACCATGCCA
TAAAATTAAATTTTAAAAAAGAGCATCTATGGGATCCTCCNCTATAGCGAGAATGTGTGA
CCGGTTCCCAATGTACGGCTTTGGGTTCCCAATGTACGGGTTCCGGTTCCCAATGTACGG
CTTTGGGTTCCCAATGTACGTGCTATCCACAGGAAAGAGACCTTTTCGACCTTTTTCCCC
TGCTATGGGATCCTCCCTATAGTGAGACGTAGACCGATGCAAGGGCACTCGATTGCCCTT
AGGGATACGGACATGTGTGTCTATATGATCAGAGGAGAAGGGAATTCGGGCATGCTACAC
TATGTTGACGATAATTTTCTCCTTGACATGGAGGTCCAGCAGACTCTGGATGACCTGCTC
CCCAGTCTTGACAGTGAGGACTCTCAGGTCCTCTATATGAATCCTTGACTCCATGAGAAC
TGGGGATCCTCTA
GenBank Accession BX002219 [GenBank]
Graphic View Graphic view of gene At3g56230
Predicted Position of Insertion Chr3:20861439 - go to primer design
BLAST e Value 2e-49
Hit Clone Code (BAC ID) F18O21
Hit Gene Code At3g56230 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation BTB/POZ domain-containing protein
Insertion Classification CDSi
Confirmation Status unknown

Gene hit At3g19590

 
Sequence (A. th genome BLAST matches underlined)
>36-K016998-022-362-D05-8409
GATCTGTAATTTCCCGGACTGAAGCATTTACATTGAATATATCCTGGAAAAANAAAAGAA
GACACAAGGAATATACTTTTTAGCTTGAGCAGCCTCTGACAGATCAAAAAACTCCATTGC
AACCCTTCCTTCAACAGAGCTAAGAGCATAGCCTGTAAATTTTCAATTTCCGAAATTCAT
TGGTATGGAAGAAGAGGAACTGAGAGTATACTTTGGAATTGGAAGAAAAAATTAGCAAGG
ACAGAAACAATATGTCAGTCATCTAACCTGTTCCATTAGGATAACAACGCACACATCTCG
TCTGGTATTTCAGTGAAGACTCCCTTCTTTGCTCAGGCTGAGACATATTTCTGAGATCAT
AGATGTTTACATGCCTCTCCTGCTGTAGCCACTACCAAACGATGTCCAACAAGAGACATA
GAGTAAACACGTTCTGGTTGCAAATATGTTCCCACTTGGGTGCGTTCAGGCCCACTATGG
GA
GenBank Accession BX002220 [GenBank]
Graphic View Graphic view of gene At3g19590
Predicted Position of Insertion Chr3:6807195 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) MMB12
Hit Gene Code At3g19590 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Transducin/WD40 repeat-like superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40