SimpleSearch - Line and FST details


Line specific information

 
Line ID 363A08
Vector Used pAC161
Line Availability only available from NASC (N434760)
Segregation Analysis 60:56:50
Confirmed for Hit At3g51880
Parent of DUPLO pair none
Parent of pair(s) 12310

Gene hit At3g51880

 
Sequence (A. th genome BLAST matches underlined)
>57-K017000-022-363-A08-8409
CTCCCTATAGTGAGAGATAGTTTACATGTACGGTAGTCTTTTTATGGGATACTCCCTATA
GTGAGACCANCGTTTTT
GenBank Accession BX002300 [GenBank]
Graphic View Graphic view of gene At3g51880
Predicted Position of Insertion Chr3:19247904 - go to primer design
BLAST e Value 3e-05
Hit Clone Code (BAC ID) ATEM1
Hit Gene Code At3g51880 [TAIR] [MIPS] [SIGnAL]
Gene Annotation high mobility group B1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At4g25520

 
Sequence (A. th genome BLAST matches underlined)
>57-K016995-022-363-A08-8409
TGATCTGAAATTTCCNGGACATGAGCATTTACAATTGATATATCACTGTATGCATAGTCT
ACTCTATGGGATGCCTCCCTATAGTGAGATCAAAGATTCAAATAGAGGACCTTTTTTAAC
TCAAAAAGAGGGTGGCGAACAGTTCATACAGAGTCTCTTACGACTCAATGACAAGAAGAA
AATCTTCGTCAACATGGTGGAGCACGACACGCTTGTCTACTCCAAAAATATCAAAGATAC
AGTCTCAGAAGACCAAAGGGCAATTGAGACTTTTCAACAAAGGGTAATATCCGGAAACCT
CCTCGGATTCCATTGCCCAGCTATCTGTCACTTTATTGTGAAGATAGTGGAAAAGGAAGG
TGGCTCCTACAAATGCCATCATTGCGATAAAGGAAAGGCCATCGTTGAAGATGCCTCTGC
CGACAGTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGT
TCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGATATCTCCACTGACGTAAGGGATGA
CGCACAATCCCACTATCCTTCGCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTT
GGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCCCGCCTTCGGGTTAACTATCAG
TGTTTCCTTGCCGATATACAGTAGTACAATAGTCAAAAGCTA
GenBank Accession FR808826 [GenBank]
Graphic View Graphic view of gene At4g25520
Predicted Position of Insertion Chr4:13035752 - go to primer design
BLAST e Value 1e-06
Hit Clone Code (BAC ID) M7J2
Hit Gene Code At4g25520 [TAIR] [MIPS] [SIGnAL]
Gene Annotation SEUSS-like 1
Insertion Classification CDSi
Confirmation Status unknown


Last Updated on 14.10.2014 10:23