SimpleSearch - Line and FST details


Line specific information

 
Line ID 363B11
Vector Used pAC161
Line Availability only available from NASC (N434775)
Segregation Analysis 100:94:65
Confirmed for Hit At2g22780
Parent of DUPLO pair none
Parent of pair(s) 1119, 3992, 4290, 8350

Gene hit At2g22780

 
Sequence (A. th genome BLAST matches underlined)
>82-K016995-022-363-B11-8409
TGATCTGTNATTTCCCGGACTGAAGCCATTTACAATTGAATATATCCTGCGGCTGCGGCT
GCCCGAGAAATCCACGAACCTAAAACAAAGTTTTCCAAAAACATTCACAACAATCTCTAT
ATGATCTTAACAACAACAATCATCGCTATGGGATCCTCCCTATAGTGAGANNNNNGNNNA
NATCCCTGCNANAGATGANTGATGACGATTATGAGTATATTCGCGTATCGGTATAGGAGA
TTTTAGGTGTGTCATCTCTTATTCAAGAAGATGTTGCTGTTGGAATTTCGTTCCCATGTG
CGCATAGATATCTATGGGATCCTCCCTATAGTGAGAGAGAAACAGAAAG
GenBank Accession BX002316 [GenBank]
Graphic View Graphic view of gene At2g22780
Predicted Position of Insertion Chr2:9691279 - go to primer design
BLAST e Value 1e-44
Hit Clone Code (BAC ID) T30L20
Hit Gene Code At2g22780 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation peroxisomal NAD-malate dehydrogenase 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03