SimpleSearch - Line and FST details


Line specific information

 
Line ID 363E03
Vector Used pAC161
Line Availability only available from NASC (N434803)
Segregation Analysis 50:50:30
Confirmed for Hit At3g41768
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g41768

 
Sequence (A. th genome BLAST matches underlined)
>21-K016995-022-363-E03-8409
TGATCTGTAATTTCCCGGACATGAAGCATTTACATTGAATATATCCTGACCTTTTATTGT
GATATAGCTACACTGTGTCTTCGGACTCGTACACACATCGGAGTCAATGTGCCAAACAGT
TCTCAGCCGAAACTACAGCTTTCTTAATAGCCGGTTGAAGCAATTCACGTCTCTTCTGAG
TCTCCGCCTTTGCTTGTGCTCTATCAGCTTCAATTGCAGCCTTTTGAGCTTCGATTCTTC
TCTTCTCTTCTTTTTGCCTCTCCCTCTCAGCTTCTTCCTTGGCTAACTTCTCTTGCTCTC
GCAGTTTCTCTTCTATGGGATCCTCGCCTATAGTGAGACCACATCCGCTATGACATCCTC
ACTATAGAGAGCTCAAAGCAAGCCTACGCTCTGGATACATTAGCATGGGATAACATCATA
GGATTTCGATCCTATTGTGTTGGCCTTCGGGATCGGAGTAATGATTAACAGGGACAGTCG
GGGGCATTCGTATTTCATAGTCAGAGGTGAAATTCTTGGATTTATGAAAGACGAACAACT
GCGAAAGCATTTGCCAAGGATGGTTTCATTAATCAAGAACGAAAGTTGGGGGGCTCGAAG
ACGATCAGATACCGGCCTATGGGATACCCCTAAGGATGGCGACCAGGGATTAGCGGGTGG
TGCCTATAAGGATCCACTTGCACCCTAGAGAAAAACCAGAGTTTTGGGTTCCGGGGGGGA
GAAGGGCGCCAAGGGTGAAACCTTAAAGGATTGAACGCAAGGGCCCCATAAAGAGGGGAA
CCCGCGGCTTAATTTGGATTCAAACGGGGGAAACTAACGAGGGCCGAAAATGGTAGGGGT
GGACCAAATGAAAACTC
GenBank Accession CT026296 [GenBank]
Graphic View Graphic view of gene At3g41768
Predicted Position of Insertion Chr3:14198134 - go to primer design
BLAST e Value 5e-130
Hit Clone Code (BAC ID) F21A14
Hit Gene Code At3g41768 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation rRNA
Insertion Classification TS2TE
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CT026296 [GenBank]


Last Updated on 31.08.2016 09:40