SimpleSearch - Line and FST details


Line specific information

 
Line ID 363H08
Vector Used pAC161
Line Availability only available from NASC (N434844)
Segregation Analysis 50:49:41
Confirmed for Hit At3g15030
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g15030

Sequence (A. th genome BLAST matches underlined)
>64-K016995-022-363-H08-8409
TGATCTGTAGATGCCNGGACATGAGCCATTTACAATTGATATATCCAATGGAAGTCTTAG
CCTTTTTGATAGCCAATCAACGGCTTTGCTATGGGATCGTCCCTATAGTGAGAATGTGTA
TTTGAGTAAAACAGCTTGCGTCATGCGGTCGCTGCGTATATGATGCGATGAGTAAATAAA
CAAATACGCAAGGGGAACGCATGAAGGTTATCGCTGTACTTAACCAGAAAGGCGGGTCAG
GCAAGACGACCATCGCAACCCATCTATGGGATCCTCCCCTATAGTGAGANNNNANNNNNN
AANNNNNNNNCNNANNNTNNTTCTTAGGNATAGCCGTGAGAGCTGTTCCACTGTCGTTCA
CAAGAAAGGATCGTAGAACGAGACCCAGGTATTGGCAAGAGGAGTGCGCATACGAAAGTT
ACTATGAGGACTATGATGTAAACTTTGATATACTAATACTGAGACGGGGACTCTGTCACT
TTTAACATAGGCAGCCGAGTTCCGGTCTGCCGCGAAAGATAAAAACTTTGCTT
GenBank Accession BX002397 [GenBank]
Graphic View Graphic view of gene At3g15030
Predicted Position of Insertion Chr3:5062608 - go to primer design
BLAST e Value 4e-13
Hit Clone Code (BAC ID) K15M2
Hit Gene Code At3g15030 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation TCP family transcription factor 4
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Related paper(s) [Koyama et al. 2010, tcp4-1]


Last Updated on 31.08.2016 09:40