SimpleSearch - Line and FST details


Line specific information

 
Line ID 364C05
Vector Used pAC161
Line Availability only available from NASC (N434877)
Segregation Analysis 100:99:78
Confirmed for Hit At2g26330
Parent of DUPLO pair none
Parent of pair(s) 2875, 3209

Gene hit At2g26330

 
Sequence (A. th genome BLAST matches underlined)
>35-K017002-022-364-C05-8409
TTTCCCGGACATGAAGCATTTGCTTATCCCTATCTACCTGTTAAAAATTGTTTTTGTACA
ATGAAACTAATACTCTGTATACACATAATGAGGTCACTATAGTGCGATCCATGAACATGT
ATTGGATTGGTGATCTATCTAATAGTCTCGTGTTTCTTAAAATTGCTTGCAAGAGACTGG
AAAATAATAACCTGACTGGTAATGTTGGTTCATTAACCAACTGTCTCAGTCTCACTGAAT
TGTAAGTACGCACCTTTGGATCTGAAACATTTTTTGTCCCTCTTTGTGCATCTTTTGCTA
ATAATATAACCCTGCAATCTTCACTAACTCTTATAAGAATGTATCTCANTAACAACCTCG
TAGGTGATATCCCTAAGAACAATAACTTCTCAAGATTTTCACCAGACAGGTATGGTAATT
TAGCAGGTTTTGGTATTGTGCATTTTGTTTTGTTTGCTAATATCTATGTTTATGTTTTTG
GATAAAGCTTCATTGGCAATCCTGGTCTTTGCGGTAGTTGGCTAAACTCACCGTGTCATG
ATTCTCGTCGAACTGTACGAGGTGATTACATTCTTCTAAAAGCTTCCATTCACAAAACCT
AAGATAATTAAAGCTCATGTTTCTATCCATGTTTTGTCTGCAGTGTCAATCCCTATGGAC
GCCCCCCCCAAAAAAGGGAAAANGNNNNCNCNNNNCCCCCCCCCCCNNNCCCCCCCCCGG
AGGGAAAANCCCCCCCCCCCCAAAAAAAGGNNNCGCGCGCGGGCCGCCGGGGAAAAGCGA
CAAACCACGCCCNANGGCCCGCAGAAGAAAAACCCGGGGGGGGGCGCCGCAAGGGGAAAC
ACGGAGGACAAAGGGCAGAAGGCCAGAANGGGCAAAACCGGGCGGCGAAAAAA
GenBank Accession BX002443 [GenBank]
Graphic View Graphic view of gene At2g26330
Predicted Position of Insertion Chr2:11210411 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T1D16
Hit Gene Code At2g26330 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Leucine-rich receptor-like protein kinase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX002442 [GenBank]


Last Updated on 31.08.2016 09:40