SimpleSearch - Line and FST details


Line specific information

 
Line ID 365E12
Vector Used pAC161
Line Availability only available from NASC (N435004)
Segregation Analysis 50:46:46
Confirmed for Hit At2g19190
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g19190

 
Sequence (A. th genome BLAST matches underlined)
>93-K017039-022-365-E12-8409
TTTCCCGGACTGAACCATTTACATTGATTGATTTTCCAGAGAAAACACACACTTCATTGA
TTGATTTTCGCATGTTAGATTTAGTTAAATGTAATTTCAAGATGGGACTTCCCGAACCTT
GCGCTGCATCTAATGATATCTTCAACCTCTCTTCCCAGCTCAAGATAAATGACCTTTTAC
CTTCACAAAATGAAACAAAACCAAAGTTCCTTTCTCAGTACATTATGAACATAAGATTAG
TGAACAAAAGAAGAATCATTAATTAACCTGCCAAATAGTCTCCTAAGTTCTCATTAGCCA
TATACTCATAGATAAGCACCATGTGGTTTATTTCGTTGCAATATCCAACAAGAGAAGTCA
GGTTCGTGTGATGAACTCTCATGAGAAGGTCAACCTGCGATTCTCAGCTATG
GenBank Accession BX002590 [GenBank]
Graphic View Graphic view of gene At2g19190
Predicted Position of Insertion Chr2:8326768 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T20K24
Hit Gene Code At2g19190 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation FLG22-induced receptor-like kinase 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03