SimpleSearch - Line and FST details


Line specific information

 
Line ID 365G02
Vector Used pAC161
Line Availability only available from NASC (N435018)
Segregation Analysis 50:42:40
Confirmed for Hit At5g10740
Parent of DUPLO pair 2403
Parent of pair(s) none

Gene hit At5g10740

 
Sequence (A. th genome BLAST matches underlined)
>15-K026821-022-365-G02-8409
GTTACAGCGAAAACACAAATTTAATTATCACCAAGACCAATCTTAATGTCATGACTCCTG
GCACAAATGAACTATCAGGATTCATAAACCAGGCTAAGTTTCTCAAGAGTAATGTATAAG
TTCTTGTTAAGAACAGAGAGGGAAGATACCATCAAAAACTCCAAATAGACCAACTATTTC
TCCATTGATACCGTCGATCCTAGTTTCAAAAAAGTCTTCCATAGATGATCTCTTGCCAGC
GGAGCTTGCATATCCATAGCTAAATTTTCCATTCTGGCTGCAATAGAATCATATCACGTA
TGGGATCCTCCCTATAGTGAGACCTATTAATCNNTCCTTTTTTTATTCTCCCTAAATCAA
AAATCATGAGAAAAACAA
GenBank Accession CR396522 [GenBank]
Graphic View Graphic view of gene At5g10740
Predicted Position of Insertion Chr5:3395168 - go to primer design
BLAST e Value 4e-157
Hit Clone Code (BAC ID) MAJ23
Hit Gene Code At5g10740 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Protein phosphatase 2C family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX002604 [GenBank]

Gene hit At4g32800

 
Sequence (A. th genome BLAST matches underlined)
>15-K017044-022-365-G02-8409
TTTTAAATATCATGGTTATTACTCCAAAATGTATTTTACAAGAAACATAAATGAATTGGT
CAAGTCGGCAACCCTATGGGA
GenBank Accession BX002605 [GenBank]
Graphic View Graphic view of gene At4g32800
Predicted Position of Insertion Chr4:15819451 - go to primer design
BLAST e Value 8e-33
Hit Clone Code (BAC ID) T16I18
Hit Gene Code At4g32800 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Integrase-type DNA-binding superfamily protein
Insertion Classification Promoter
Confirmation Status unknown


Last Updated on 07.07.2016 14:03