SimpleSearch - Line and FST details


Line specific information

 
Line ID 365G09
Vector Used pAC161
Line Availability only available from NASC (N435025)
Segregation Analysis 45:35:33
Confirmed for Hit At5g61780 At5g21150
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit F7B19

 
Sequence (A. th genome BLAST matches underlined)
>71-K026821-022-365-G09-8409
TACTTCAGACCTTCCGCTATATTTTGATAGGGGATCCTTCCGATAGTGTGTCGAAACATC
TTTTTTTTTGGTGAAAGATGGATCGTAAGACGTTCTCCCTATAGGGATCCCCCCTACCCT
AGAGGGATTGGAATTTCCGTTTATTCCAAATGTTAAGTTTAAACATGATCTATTAGTTAG
GCTTGTTCGTGTCTAATTTAAGTGCAAGGATTACTTTGCACATAAGGAAAACTCTAGGGC
TTCTCAAAGACTTGTTGAAAAACAGGATTTCCCTCACTCTAAATAAGGGTTTCAATCGAC
ATAGGTATGGTGNCNANCGACACGNACTTCTGAGAAACGACTTTGATAGTCTTCATTGCT
GAGAGGCTTTC
GenBank Accession CR396527 [GenBank]
Graphic View Graphic view of sequence CR396527 of line 365G09
Predicted Position of Insertion Chr2:3741630 - go to primer design
BLAST e Value 2e-51
Hit Clone Code (BAC ID) F7B19
Insertion Classification Genome Hit
Confirmation Status unknown

Gene hit At5g61780

 
Sequence (A. th genome BLAST matches underlined)
>71-K017039-022-365-G09-8409
AGTAGATCGAAAACCCCTTACGATTATTCTCTATAGGTCTTCAGTACTGGATTATATCTT
ATTGCTATGGGATCCCCCCTATAGTGAGAAGAATCAGGATAAGGTTAGTCCTTACATTGC
GGAGCTGGAACAGCTTGAAGAGCAGGCTCAGCAGGAAGGATTTGGTCGTTGGAGCAAGGT
TGGTGTCTCTTAGTCTGTTTCTCTAAATTTGGTTTATCAAAACACGTCTATGGGATCCTC
CCTTATAGTGAGANNNNNNNNNANNANCCACCTNCCTTTTCCNCTATCTTCACAATAAAG
AGACACACANCTGGTCAATGGAATCCTAGGAGGTTTCCGGATATTACCCTTTGCTGAAAA
GCCTCAAGTGCCCTTTGGACTTCTGAGACTGGATCTTTGATATATGTGGAGTAGACAAGC
GTGTCGTGCTCCACCATGTTGACGAAGATTTTCTTCATGACAATGAGACTTAAGAGACTC
TGTATGAACTGATCGCCAGTCATTACGGCGAGGTCCGTTAGGCCCTCTATTTGGACCCTT
GACTTCATGGGCAACTGGGGATCCTCTA
GenBank Accession BX002614 [GenBank]
Graphic View Graphic view of gene At5g61780
Predicted Position of Insertion Chr5:24822576 - go to primer design
BLAST e Value 6e-74
Hit Clone Code (BAC ID) MAC9
Hit Gene Code At5g61780 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation TUDOR-SN protein 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At5g21150

 
Sequence (A. th genome BLAST matches underlined)
>71-K017044-022-365-G09-8409
GGGATAAGGCTCCCGGACTACTCCTGATACTTGAATGGAACCCTCTGGAACGACTGACAC
CTCCACCAAGTAGGTACAAACGTTCTTTACGTCATTGTGGGAAAGAGGACCGGCGAACAA
CGAGGCTACCTCTGCTAGCAGATATGAGAACATGACATTAAAGATCAACGCAGAGAATTT
ATTTGAAGTACAAATACCCAGAATATTTAACTTACTGCCTATGGGATCCTCCCTTATAGT
GAGACNNATAGTGAGANNCNCNNCCNTATATGCTTTTGAGTTTATTCTTTTATATTGGTC
GGTGACCGCCGCATTTACATGGAGGAAACCTAACGACAAGGGAGAATTTGAGGAGGTTGA
GATCACAGTGCTCAATTACTATAAAGAGCGTAACATTGAAGTGCGTTATTCAGGTGACTT
CCCTTGCATCAATGTTGGTAAGCCGAAGCGTCCCACTTACTTCCCCATTGAGGTAAATAA
AATGAATTGTTGTTTTTCTGTTTTCCACATATTTTTTTGTAACGGATTATGACAATCGTT
TTGGTTTTCATGTTTGCAGTTCTGTAATCTTGTGTCTCTACGGCGATACACAAAATCGCT
TACCAATTTTCAGAGGGCTGCCCTA
GenBank Accession BX002615 [GenBank]
Graphic View Graphic view of gene At5g21150
Predicted Position of Insertion Chr5:7194618 - go to primer design
BLAST e Value 7e-163
Hit Clone Code (BAC ID) T10F18
Hit Gene Code At5g21150 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Argonaute family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX002615 [GenBank]


Last Updated on 31.08.2016 09:40