SimpleSearch - Line and FST details


Line specific information

 
Line ID 366A12
Vector Used pAC161
Line Availability only available from NASC (N435052)
Segregation Analysis 50:49:47
Confirmed for Hit At3g47070
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g47070

 
Sequence (A. th genome BLAST matches underlined)
>89-K017045-022-366-A12-8409
ATATCCTCTTTCTTTTTTCCCTTCACCATTTTTCTTTGAATCACTTGGATACATTTTTTT
TGGTTTAATTGTTTTTAGATATATCTTGGCACAATTTATGGGTATTCTTCTCAAGTTCTT
AAACGGAAATTTGCACAGAGAGTCCAAGTCTTCAATTTCAGATTTATAATTTATTTGTCA
AATGAAATGTATGAATGCGGAAGAGACACGACTTGATTTTTTTTAAGGGTGTGATCTTGT
CCCTGACCATGTTGGTTGTTAGCTGCTGCAACTTGAGACTCTGATCAAAACTAAAAACCT
TTTTTCTGTTATTGGGCCGACGAGGCCCATTTCTTTAAAAGGAACTGTGACAAGATGGGA
TATAAAGCCCTATGGGACTCCCCTATATAGGGAGACNCNGNTTTCATTCTCTATAATTTC
TTCNGATTTCACTTATATATAAAGCTACTCTTTTCTAATCTTTATTTGACATCACATGA
GenBank Accession BX002656 [GenBank]
Graphic View Graphic view of gene At3g47070
Predicted Position of Insertion Chr3:17337632 - go to primer design
BLAST e Value 2e-166
Hit Clone Code (BAC ID) F13I12
Hit Gene Code At3g47070 [TAIR] [MIPS] [SIGnAL]
Gene Annotation unknown protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit FR808897 [GenBank]


Last Updated on 14.10.2014 10:23