SimpleSearch - Line and FST details


Line specific information

 
Line ID 367A12
Vector Used pAC161
Line Availability only available from NASC (N435148)
Segregation Analysis 100:81:67
Confirmed for Hit F6I1
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit F6I1

 
Sequence (A. th genome BLAST matches underlined)
>89-K017046-022-367-A12-8409
TGATCTGANATTTCCCGGACATGAAGCCATTTACATTATGGTAATGTTTTTCTTTCATAT
TTTTGTTTTGTTATGTACTAATTAAATTTAAAAGCTCTTAGAAAATTTATTCAACCATTT
TTGTTAATCTTCTCATATATGATGACTTATTGTGATTGGTAATACATGGAATGAGAATAA
TATACAGAAATTGTAAATTAAGTCATAACAGTATTATTTTGATTCACAATGGAGTTGGAG
AAATGAATTATCAATATAAAAAATCATGGTTTCACGTAATTTGATGATTTGTTTTTAAAA
TACTCCCTATGGGATCCTCCCTTATAGTGAGANNNNNNNNNNNNNNTNNNTNNNNNTTTT
TTTTTTTTTTAAATTCGGAAGCCTCTTATNNTCCTNAAAANTNCCNCNCNCCCCNNCTTC
CCTCNCATAACCAATTTACAATCTTCAATTTNATCTCTCTTTCCTTCAACAAAAACTAAA
TTTTTTCACTTCCTCACTCACCTTCCAAACCAAAATACCTCACCTTTCCCCCCAAAACAT
ATCTTCCAACTNTTTTCCATCTNTATACCTTTCACTATGGGATCCTCCCTTATTTCTAAA
ACTTTCCCTACCTCCCCCACCCCACCCACACCCCCAAATAAAAAAAAAAACACATCCCCA
CCCCCAAAATCCCCCCCCCACCCCAAAAAAAAAATACCTAACCTCTCCCACATTCCAACA
AACAAAAAAAAAAAACAACACATTTTACCCCCCACATTTTCTCACCCCCCCAATTATTAA
AAACCCCAAACTATAACCCATAACCCAACAACCCCAACAACACACAAAACCCCTAANACC
CCACAAACAACNCCCCCCCCCCCCCAAANATGATATACTCAAATTCTACNATCA
GenBank Accession BX002784 [GenBank]
Graphic View Graphic view of sequence BX002784 of line 367A12
Predicted Position of Insertion Chr1:5828403 - go to primer design
BLAST e Value 6e-154
Hit Clone Code (BAC ID) F6I1
Insertion Classification Genome Hit
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX002783 [GenBank]


Last Updated on 14.10.2014 10:23