SimpleSearch - Line and FST details


Line specific information

 
Line ID 368B08
Vector Used pAC161
Line Availability only available from NASC (N435252)
Segregation Analysis 50:49:37
Confirmed for Hit At2g34140
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g34140

 
Sequence (A. th genome BLAST matches underlined)
>58-K017042-022-368-B08-8409
TGATCTGTAATTTCCCGGACTGAAGCCATTTACCATTGAATATATCCTGCAATTTAGTGT
CTCTCTAAGCTAAGAGGTCCTCTTAAATAAAATGTAGTGGCGATGTGACATGATTTGGTT
CGTTGGGAATAATATTAAAGCCGAATTTTTTTTCTTGACATTAATTCTTCTACTATGTAT
AATACTTCATAATATGATAGTAAAAAACGAACGAGATGGTTACACTTACTTTGATGTCTC
TGAATTCTTACAACCAGAATCAGCTATGGGATCCTCCCTATAGTGAGANTCATCTCCAAT
TCCTGCTAAAAAGTTATACTATCATCTTTCTATAAAAAGACGTCTTCTCTATTTCTTACC
CCCAACTTACTTTGGATAAGCTATTTTCCATTCTCTGCACGTTTTCATGGCGACTCAAGA
TTCTCAAGGGATTAAACTCTTTGGCAAAACTATTGCATTTAACACTCGAACAATAAAAAA
TGAAGAAGAGACNCGCCCGCCGGAGCAAGAAGCCACCATAGCCGTTAGATCATCATCATC
ATCGGATCTGACGGCCGAGAAGCGTCCGGATAAGATCATAGCATGTCCAAGATGCAAGAG
CATGGAGACCAAGTTCTGGTACTTCAACAACTAACACGTTAATCAACCTCAAACACTTTT
GGAAAGGCTGCCCACGTTACTGGACCGCCGGTGGGGCACTCCGGAACGTTTCCGGCCGGC
CCCGGTCTCGGAAGCCCAAACACCTGGTCCGGCCCGGGTTGGTATCCTTGGAAATGGAA
GenBank Accession BX002925 [GenBank]
Graphic View Graphic view of gene At2g34140
Predicted Position of Insertion Chr2:14415048 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T14G11
Hit Gene Code At2g34140 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Dof-type zinc finger DNA-binding family protein
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23