SimpleSearch - Line and FST details


Line specific information

 
Line ID 368E07
Vector Used pAC161
Line Availability only available from NASC (N435287)
Segregation Analysis 50:50:49
Confirmed for Hit At4g03270
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g03270

 
Sequence (A. th genome BLAST matches underlined)
>53-K017042-022-368-E07-8409
ACTCTCTACCTCTCGATGACTCTCGTATGTATGAGACCTAGCGCACTATGGAATTCTCCG
TATCTGATGATCCGGTAACTTAAAACTCATGAATCTTTATAATGTGAATGTGTTTTAAAG
TGTTGATAAGTGTCTGAACATTGGATTTTTTTCAGGTGGAAGGTGAGTTTTTTGATGCTC
AGATGATAGAGAGAATGGAGAATGTGATTCTATGGGATCCTCCCCCTATAGTGAG
GenBank Accession BX002983 [GenBank]
Graphic View Graphic view of gene At4g03270
Predicted Position of Insertion Chr4:1433258 - go to primer design
BLAST e Value 5e-62
Hit Clone Code (BAC ID) F4C21
Hit Gene Code At4g03270 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Cyclin D6;1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23