SimpleSearch - Line and FST details


Line specific information

 
Line ID 368H02
Vector Used pAC161
Line Availability only available from NASC (N435318)
Segregation Analysis 50:14:12
Confirmed for Hit At1g17880
Parent of DUPLO pair 185
Parent of pair(s) none

Gene hit At1g17880

 
Sequence (A. th genome BLAST matches underlined)
>16-K017042-022-368-H02-8409
CAGCTGGTGCTTTCTCTTCGCAGCAGTTTCTAATGTCTCTCCAACTGGGTCTGGGACATC
GTCATCATCCTCTTCTTGTATGGTTGCTGAGGCGGCATTACCTTCACCAAAAGCCTGTTT
CTGGAACTGCTCTGCTATGGGATCTCCCCTATACTGAGATGTGTGACCGGTTCCCAATGT
ACGGCTTTGGGTTCCCAATGTACGGGTTCCGGTTCCCAATGTACGGCTTTGGGTTCCCAA
TGTACGTGCTATCCACAGGAAAGAGACCTTTTCGACCTTTTTCCCCTGCTATGGGATCCT
CCCNTATAGTGAG
GenBank Accession BX003026 [GenBank]
Graphic View Graphic view of gene At1g17880
Predicted Position of Insertion Chr1:6152589 - go to primer design
BLAST e Value 4e-53
Hit Clone Code (BAC ID) F2H15
Hit Gene Code At1g17880 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation basic transcription factor 3
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03