SimpleSearch - Line and FST details


Line specific information

 
Line ID 369A03
Vector Used pAC161
Line Availability only available from NASC (N435331)
Segregation Analysis 100:100:77
Confirmed for Hit At1g12980
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g12980

 
Sequence (A. th genome BLAST matches underlined)
>17-K017072-022-369-A03-8409
TGATCTGTAGATTTCCCGGAATGAAGTCATTTACGATCTTCGGCAAGTACAGCCTAACTG
AGTTCCGTACATCAACATTTCTTGATACCCCCACTCGTTTGATCCCAACGATAAACCACC
GTCTGCGACGGCTCTTACGCCGTCGTCATTAGCTTGAAAATTCCCGTAGCGATCTATGGG
ATCTCCNCTATAGTGAGAANGAACGGGAACCGTATTTACAGAGTATATCTGTGAGATTAA
AGGAGCAAGCTCTATCCACAGGATAAGATATGTGATCACCTCTATAGAGAGAAATGGGAG
CCTAGCTAGAGCGAGACCAATACCATAGAGTGATGATGGGAGATCCGCTACTATAGAGAG
ATGTGACTAAGATCCTCGGAGCTTCTTCCCTGCCTGAACACAACTCTCTTAATAGAAACA
TCGGAGAGAAGGA
GenBank Accession BX003046 [GenBank]
Graphic View Graphic view of gene At1g12980
Predicted Position of Insertion Chr1:4430769 - go to primer design
BLAST e Value 9e-76
Hit Clone Code (BAC ID) F3F19
Hit Gene Code At1g12980 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Integrase-type DNA-binding superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40