SimpleSearch - Line and FST details


Line specific information

 
Line ID 369C03
Vector Used pAC161
Line Availability only available from NASC (N435355)
Segregation Analysis 50:48:32
Confirmed for Hit At4g11330
Parent of DUPLO pair none
Parent of pair(s) 89650, 89660, 89669, 89677, 89684, 89691, 89692, 89693, 89694, 89695, 89696

Gene hit At4g11330

 
Sequence (A. th genome BLAST matches underlined)
>19-K017072-022-369-C03-8409
TGATCTGTAGATTTCCCGGACTGAAGCCATTTACATTGTTCATCATCATAGCCGAGAGAC
GGATTTACTGGATCAACACCACCATTTTCTGCTATGGGATCCTCCCTATAGTGAGAACTG
TGTTATCCTTACTTGTCGGCTCTTCACGACCTTAACGACGAGCCTGTTTGTTCCAACCAT
TTCAGTTTCCATTTTGAGGATCCGTCTTCCACTGAAGAAGACATAAAGGAGCTTGTGTGG
CTCGAATCTGTGAAGTTCAATCCTCTGCCGAGCATTTAAAACATTATTTAAGAAGGGGAA
AGCAAGTTTTATACTCTGACATTGAGCAAAACAAATTAGTAGTGTTTAAGCTCTGTTTCT
CCTTCATCTCATGTTGATCGTTGTTTAAGCTATTTCGCTATGGGATCCCCCTTATAGTGA
GAGNNGAAAAGNCTCCATTGCCCTTTGGTCTTCTGAGACTGTATCTTTGATATTTTTGGA
GTAGACAAGCGTGTCGTGCTCCACCATGTTGACGAAGATTTTCTTCTTGTCATTGAGTCG
TAAGAGACTCTGTATGAACTGTTCGCCAGTCTTTACGGCGAGTTCTGTTAGGTCCTCTAT
TTGAATCTTTGACTCCATGGGAATTGGGGATCCTCTATGGGATCCTCCCTATAGTGAG
GenBank Accession BX003080 [GenBank]
Graphic View Graphic view of gene At4g11330
Predicted Position of Insertion Chr4:6893625 - go to primer design
BLAST e Value 4e-152
Hit Clone Code (BAC ID) F8L21
Hit Gene Code At4g11330 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation MAP kinase 5
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX003080 [GenBank]


Last Updated on 31.08.2016 09:40