SimpleSearch - Line and FST details


Line specific information

 
Line ID 372E03
Vector Used pAC161
Line Availability only available from NASC (N435667)
Segregation Analysis 50:50:33
Confirmed for Hit At5g60740
Parent of DUPLO pair none
Parent of pair(s) 2183, 91840

Gene hit At5g60740

 
Sequence (A. th genome BLAST matches underlined)
>53-K035338-022-372-E03C-8409
TGAGCCATTTACAATTGAATATATCCTGGCTTACTTCCTAGCGAAAGACACAGTTGATCA
CTTCAACACCATCGTTAAGCCGCTTGTTTATCTATCCATGTTCTACTTCTTCAACAATCC
AAGATCAACAGTTACAGACAATTATGTTGTCCTCATCTGTCTTGTATACTGTGTGACTGG
TATAGCTTATACCCTGGCCATACTTTTCGAACCTGGTCCAGCTCAACTAGTAAGTGTCTC
ATCAATGCTGTTGATAGAACCAAAGACTCG
GenBank Accession HG968935 [GenBank]
Graphic View Graphic view of gene At5g60740
Predicted Position of Insertion Chr5:24426529 - go to primer design
BLAST e Value 3e-137
Hit Clone Code (BAC ID) MUP24
Hit Gene Code At5g60740 [TAIR] [MIPS] [SIGnAL]
Gene Annotation ABC transporter family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At2g07783

 
Sequence (A. th genome BLAST matches underlined)
>21-K017096-022-372-E03-8409
TTGCTTTCTTCTCTCTGTACTACTGCTTCCTTGACTTTTCTTGCTATAAAATGTTCCTCA
ATAGCGCTGATTCTGCAAATATTTCTAACGAAGCAACTGTCTTTTCAAAGCACTATCTAC
TGGGGATATCACCCAGCACTATATTTTGTCGAACCATGCTAAGCAAAGATGCACGGTTCC
AGGCTTCTTTCCCTCCCCGGGTCCACTATGGGATCCTCCCTATAGTGAGACGCCACGAAN
GGGCAGAAACGCACGACCGGGAGGGAGAATGGGGCGCCTGATATAGACGGATGCGGACGG
ATAAGGAGAAGAAAGGGGAAAAGCACGAGGGAAGCGGGGAGAGGACCGCCAGGGCAGGCA
CCGAGAACGGGGGCTACAAGGGACGGGGAGGGCGAACCACAAGAGGGAACAGAAGATGGC
CCACAGCGGCGCGGAAAAAGGGAGAGGGTGGTGACGGCCGGACGAAAGACCAGAGGTACC
GACCCACAGGAGGCGAAGAAGGAACAGGGGGGGACATAGGACGGCGGAAACAGGCGGAGA
CAGAAGGGGCGGGGGCGAACAAAGGGAAGCCGGGAGGAAAAGGGGCGGCCCACGCNCAAA
AACGAAAGGGGAGACAAGACGCAGGAAAACGAGGACGGGAAGGAGGGGACAGACGAGCGC
GGCGGAAACGGGGAAGGTGCGAACAAAACAATATCGGGCAACGCATGACAACACAAACCA
GGGCACGGTGGGCAGTGGAAATGAATACGGGGCGGGGAGCCAAAAGGACAGAAGAGAGA
GenBank Accession BX003502 [GenBank]
Graphic View Graphic view of gene At2g07783
Predicted Position of Insertion Chr2:3299497 - go to primer design
BLAST e Value 9e-33
Hit Clone Code (BAC ID) T17H1
Hit Gene Code At2g07783 [TAIR] [MIPS] [SIGnAL]
Gene Annotation pseudogene
Insertion Classification CDSi
Confirmation Status unknown


Last Updated on 14.10.2014 10:23