SimpleSearch - Line and FST details


Line specific information

 
Line ID 372G04
Vector Used pAC161
Line Availability only available from NASC (N435692)
Segregation Analysis 50:50:45
Confirmed for Hit At3g01270
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g18460

 
Sequence (A. th genome BLAST matches underlined)
>31-K017075-022-372-G04-8409
TATCATGTAGATTTCCCGGACATGAAGCCATTTTCAATTTTTACATTTAAACATGTGTAT
ATATAGGTGACAAAGAGGGATTACGCTTCAGAAAGCGAATGGAAAAACTGGAACTGGAGA
TCCGAGAAAGATGTTTTCATGAACAATGCATATTTCATGACAATCTGGAAATCCTCATTT
CAAGTGTTCGCATTCTATGGGATCCCGCCTATAGTGAGAATCCGAAACTTTGATTATTAT
CCCTTTAGTGACTGCAAAATATGTGTGAATGAGTGTGTACAACTTAAACTTCAAAACCTT
TTTGATATCACAAAACTTGAAATGGATTAAATCTTTATATCAGGTAAAATTTGTTTTGGG
ATATAACTGGCTTCTATATTGCTTAAATTTGGGGGTAACCAGCTGGGGGTATTTCTAAAC
AAATATTCTATATGGGGAAACAAAAAATAAAACTGCAACTAAGTTTTGAAAATTATTGAT
GTAATGATAAATGATAATGGTAAACATGATTTATGCACTAATGGGTATTGTTTAATTTGC
TTGGCCAAAACTCAGAACTCGAATGACCTTGACTTGTGCAATTAGTTGACGTTTTTAGGT
ACAGATTATTTTTGTACCAAAGCCAGACCCCAAATATATCGAATAAGGAAAAAATAAGCC
CCTCTTGAATGAAAAAATACGATCTTCCCATTCCTTTTATTTTTCCCTATCAAAATAAAC
AATATTGATAAAATCTGAAAAAGAATTTAAAATAAAT
GenBank Accession BX003528 [GenBank]
Graphic View Graphic view of gene At3g18460
Predicted Position of Insertion Chr3:6334210 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) MYF24
Hit Gene Code At3g18460 [TAIR] [MIPS] [SIGnAL]
Gene Annotation PLAC8 family protein
Insertion Classification 5' region
Confirmation Status unknown

Gene hit At3g01270

 
Sequence (A. th genome BLAST matches underlined)
>31-K017096-022-372-G04-8409
TGATCTGAAATTTCCCGGACATGAAGCCATTTACATTGATTTGATGCCATATATATATGT
GCACACTCAAATCATTTTGGACCTCTCTGTAGTGTTGTTTGTGAGGAGGAGCGATGAAAC
GGTTTCCATGGCTGAGAATGGTAGGACCTTGGCTACCACCGATCGCGTAAAGCTCCCAAT
GAGTGTAGTCATTGTTGACAACGTGGACGAAACCCCATCGGACCCTATGGGATCCTCCCC
CTATAGTGAG
GenBank Accession BX003529 [GenBank]
Graphic View Graphic view of gene At3g01270
Predicted Position of Insertion Chr3:83147 - go to primer design
BLAST e Value 2e-104
Hit Clone Code (BAC ID) T4P13
Hit Gene Code At3g01270 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Pectate lyase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23