SimpleSearch - Line and FST details


Line specific information

 
Line ID 373B06
Vector Used pAC161
Line Availability only available from NASC (N435730)
Segregation Analysis 51:50:46
Confirmed for Hit At1g04180
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g04180

 
Sequence (A. th genome BLAST matches underlined)
>42-K017159-022-373-B06-8409
GATCATGTAGATTCCNNGACATGNAGCCATTTACAATTGAGGTTGTTCTAACCCTCCATA
GCCCACTATGGGATCCTCCCTATAGTGAGATCACTAAGATTTTCGTGAGGCTAAGCAACA
AAATTACTATAATGTAGTGTATGGATAATTTGCCTATAGGAACCTCATTATCGATTCGAA
TATTGAGATTGCATATATCTCCCTATTGTGAGCTTCTTAAGTCCAACCATCACACACTAA
ATGTGTGTATGAAGATCTCATGTATCCGCTTTTTTTAAATGTTGTAGATACTATAAGACT
TTTGCGATTTTATGAATATAAATTGATCGCTAAGCTAAGGGAGGGTCCCTACGTATACTA
TGGTACGCTTTTTTTTACGAGAGGCGCGGCCCTGTAAATACTATACTATATTAAGATTGC
ACTAGGGAGGCTAACATATCGTGCGCCTACTTAAACTGATACTCAAACTATGGGGATTCC
GCCTATGGAATCCTCTGTAGTGTCGCCGAACGAGTAATGACTCCCCANGCGGGATACTTA
A
GenBank Accession FR809031 [GenBank]
Graphic View Graphic view of gene At1g04180
Predicted Position of Insertion Chr1:1105033 - go to primer design
BLAST e Value 6e-06
Hit Clone Code (BAC ID) F20D22
Hit Gene Code At1g04180 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation YUCCA 9
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At1g51538

 
Sequence (A. th genome BLAST matches underlined)
>42-K017165-022-373-B06-8409
NNGGAAAGGTGTAGATTTCCNGGACATGAGCCATTTACAATTGAGGTTGTTCTAACCCTC
CATAGCCCGCTATGGGATCCTCCCTATAGTGAGATTTGGACAAGCCATTTAAAAAAGGTT
ATCTCCGAAAAAAAGAGGGAGAACGATAATGGCGCTGGAATGGAACAACTTCTTTATATG
GTTACTCGAAAGAAATTAATTTGTTTATCGCACCCTAAATAAACAAAAGGAGGGCGGGTT
GACTAATCTAGACATGGCTCCAACCCGAACAAATTAAAAGTATACCGAAAACAGTAGCAT
TTGTTGTGATTCAGACCGGAAAAAAACAAAGGAGTGGGACAAGAGGACTCGGAGAGAAAC
CAAAACCGATTAGGGTTGGATTCCCCCCCCCCCCCCCCCCGGAAGATAAGGAAAATAAAA
GGGAGGGGGCGGGGNCAAAAAAAAAAAAAAAAAAACNGGGGGGGGGGGGGGGGGGGGNNN
CNCCNNCCAACAAACACGAGAGACAGAGGAGAAGAAGGAAAGAGAAAGAAAGGAAGGAGG
GAGAAGGGAAGGAAAGAAAGGGAGAAGGGGGAAAAAAAAAAGGGGAAAAAGGAGACAAAA
AAAGGGGAGCAAGGGAAAAGGAGGAACGAGAGAAGGGAAAGAAAGGGGGGGGGGGGGGGA
CAAAAACAAAAGGGGGAGGAGAGAAGGGGAGGAAGAACGGGGAAAAAAAAAAAGAAAAAG
AAAAAGAGGGGGGGGAAAAAGGGAGAGAAAAAGAAAAAAAGGAAGACAGGGGGGGGGGAA
AACGAGAAAAAAAGAGGGGAGAAAGGGGAAGAAACAAAAAAACAAGAAGAGGAGAGGAGA
AACAAAGGAAGAGGGGGCGGAGAGAGGGGCAGAAAGGGAAAAAAAGGGACGCACACAGCG
GGGACACGAGGGAAAAGGGAGGGGGGCAACAAAACAAAAGAAAAAAGAGGAGAAAGGGGG
AAAGGGAAAAAAAAAACAGAAGAGGGGAAGGGAAGGAGAGAAAAGAAAACA
GenBank Accession BX003579 [GenBank]
Graphic View Graphic view of gene At1g51538
Predicted Position of Insertion Chr1:19113134 - go to primer design
BLAST e Value 2e-24
Hit Clone Code (BAC ID) F5D21
Hit Gene Code At1g51538 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Aminotransferase-like, plant mobile domain family protein
Insertion Classification TS2TE (5')
Confirmation Status unknown


Last Updated on 07.07.2016 14:03