SimpleSearch - Line and FST details


Line specific information

 
Line ID 373C08
Vector Used pAC161
Line Availability only available from NASC (N435744)
Segregation Analysis 50:46:37
Confirmed for Hit At5g43810
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g43810

 
Sequence (A. th genome BLAST matches underlined)
>59-K017159-022-373-C08-8409
TGATCTGTNATTTCCTGGACATGAGCCATTTACAATTGATATATCGTTGGTATAACAGAG
ATTGTTAGTCAGAGATTGAATACCCATCTGCTGTGAATTGTTCTCGTCCCCAAAGACATG
GTAATGTGCAGGCCTGCTTGTTTCCTATGGGATCTCCCCTATAGTGAGANNNNNNNNNAN
NNNNNCCCNNNNTTNNNTTTNNNTNCNCAATGTACANGTTCCNTTTCACAATATACANCT
TTNNNTTCCCAATGTACNTCCTATCCACACAAAATAAACCTTTTCAACCTTTTTCCCCTA
CTA
GenBank Accession BX003592 [GenBank]
Graphic View Graphic view of gene At5g43810
Predicted Position of Insertion Chr5:17616251 - go to primer design
BLAST e Value 2e-30
Hit Clone Code (BAC ID) MQD19
Hit Gene Code At5g43810 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Stabilizer of iron transporter SufD / Polynucleotidyl transferase
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40