SimpleSearch - Line and FST details


Line specific information

 
Line ID 373H03
Vector Used pAC161
Line Availability only available from NASC (N435799)
Segregation Analysis 50:50:50
Confirmed for Hit At5g62575
Parent of DUPLO pair 2315
Parent of pair(s) none

Gene hit At5g62575

 
Sequence (A. th genome BLAST matches underlined)
>24-K017165-022-373-H03-8409
ATGAGCCATTTACATTGATATATCCATCAGTTTGAGACCTTTTCGACCTTTTATCCATGC
TATGGGATCGTCCCTATAGTGAGATTTGNNTTATTTTTTACCCAGAGAATGTTTCTAATA
ATCTCACAATAATGTTTGTTTACTCAATGAAAATGGCATCTAATAAAGTAGACTATAAGA
AAAAGACATTGTCCAGGGAAACCAAACTCTGGGTTTTTCTGACGTTGTGTGGAATCTCTG
CTTTTTCTTCTTTTTAAATATTCCTTAGCTTTTCACTTATTTGTACTTTGCTTAAAGATA
CACTCTCCATTTATAGATAACTGCAACGATTAATGGCTTATCCATTTTTTTTTTGACCGC
CCCCACCCGAAAGNGCGAATGATCAATCACACTTAATGGGTTACACTGGACATGAAAAAG
AAACGAAAGGATGGGGAGAGCGAGTGGGCCGGTTCGGTGTAGCCTACCTCTATCTTGGGC
CTCTCTCTA
GenBank Accession BX003659 [GenBank]
Graphic View Graphic view of gene At5g62575
Predicted Position of Insertion Chr5:25118529 - go to primer design
BLAST e Value 9e-141
Hit Clone Code (BAC ID) K19B1
Hit Gene Code At5g62575 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation succinate dehydrogenase subunit
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX003658 [GenBank]


Last Updated on 31.08.2016 09:40