SimpleSearch - Line and FST details


Line specific information

 
Line ID 374G03
Vector Used pAC161
Line Availability only available from NASC (N435883)
Segregation Analysis 50:49:39
Confirmed for Hit At2g21130
Parent of DUPLO pair none
Parent of pair(s) 5538, 5563, 5583, 8699, 10388, 10983, 11352

Gene hit At2g23130

 
Sequence (A. th genome BLAST matches underlined)
>23-K017166-022-374-G03-8409
TGAGCATTTCATTGATATATGATTTCATCTTTTGACTATAGTTTAGGTTATTCGTATAAT
TTAAAAATGCTGAAATCACAATTTTTTTTTTAGATTTGAAATATGCATGGGATCCTCCCT
ATAGTGAGAAGAAAAGAAGAGTATTACCATTTTTTTCCAATT
GenBank Accession BX003769 [GenBank]
Graphic View Graphic view of gene At2g23130
Predicted Position of Insertion Chr2:9844980 - go to primer design
BLAST e Value 7e-15
Hit Clone Code (BAC ID) F21P24
Hit Gene Code At2g23130 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation arabinogalactan protein 17
Insertion Classification CDSi
Confirmation Status unknown

Gene hit At2g21130

 
Sequence (A. th genome BLAST matches underlined)
>23-K017160-022-374-G03-8409
TATCATGTAGATTTCCCGGACATGAAGCCATTTACAATTGAATATTGACTATAGTTTAAA
TCACAATCAGCGATCACAACAGGCTTCGTCGGCTTTCCAGAAGAAGATCCGATCTTCTCA
ATAGCCTTAACAACGTCCAAGCCTTCAACCACCTGACCAAACACCACATGCTTACCATCA
AGCCAATCAGTCTTCACCGTACAGATGAAAAACTGAGATCCATTAGTGTTAGCACCAGCG
TTAGCCATCGACAAAATCCCAGGTCCTGTGTGCTTCCTCTCGAAATTCTCATCCTCAAAT
TTGGCTCCGTAGATCGATTCGCCACCAGTTCCGTTACCTTTGGTGAAATCTCCTCCTTGG
CACATGAAATTTGGGATCACGCGGTGAAACGAAGATCCTTTGAAGTGAAGTGGCTTTCCG
CTACGTCCGACGCCTTTCTCTCCGGTGCATAGAGCTCTGAAATTCTCCGCCGTCTTTGGT
GTCTTGTCGGTGTAAAGCTCCATCACGATCTTCCCCGCTGGTGCACCGCCGNATGGTCAT
GTCGAAGAAAACTTTAGGATGCGACGCCATTGTTGTTGTTCGATTTTGGGAACGAGGATT
TTAAAAGTGTGTGACCTAT
GenBank Accession BX003768 [GenBank]
Graphic View Graphic view of gene At2g21130
Predicted Position of Insertion Chr2:9055633 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F26H11
Hit Gene Code At2g21130 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40