SimpleSearch - Line and FST details


Line specific information

 
Line ID 376G12
Vector Used pAC161
Line Availability only available from NASC (N436084)
Segregation Analysis 80:72:71
Confirmed for Hit At1g04610
Parent of DUPLO pair none
Parent of pair(s) 84586, 84595, 84603, 84609, 84617, 84624, 84626, 84627

Gene hit At1g04610

 
Sequence (A. th genome BLAST matches underlined)
>95-K017168-022-376-G12-8409
TGTCTGTNATTTCCCGGACTGAAGCCATTTACTTCTGATATATCCTGACATCATTAAATG
TCTACAATTTAAGCTAAACCTTGAGAAGAACAATGAATGAAAGATGTTTTATTTATTACC
TTAAGCCATGAAGGGACGTTGCTTCTGTATCCAGTAGCTATGGGATCTCCCCTATAGTGA
G
GenBank Accession BX004037 [GenBank]
Graphic View Graphic view of gene At1g04610
Predicted Position of Insertion Chr1:1280845 - go to primer design
BLAST e Value 3e-51
Hit Clone Code (BAC ID) T1G11
Hit Gene Code At1g04610 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation YUCCA 3
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03