SimpleSearch - Line and FST details


Line specific information

 
Line ID 377B04
Vector Used pAC161
Line Availability only available from NASC (N436112)
Segregation Analysis 50:50:42
Confirmed for Hit At1g15690
Parent of DUPLO pair none
Parent of pair(s) none
Note Although the line exists, the insertion in At5g05690 can not be ordered because the confirmation of this insertion failed.
Although the line exists, the insertion in At4g21326 can not be ordered because the confirmation of this insertion failed.

Gene hit At1g15690

 
Sequence (A. th genome BLAST matches underlined)
>26-K026822-022-377-B04-8409
TAAAACAAGACGCGACCGAATACTATGGTGGATTTCTAAATTCTAAACAGAACAAAAAGA
AAACAGAAAGACAGAGAGTGAGAGAAAGAAACATCATTTGGTTGGTTCTTTAAATGAGCC
TCATCAACAAAAAAGGTTTTTTAACCACCTACGGTAAACGAAAATAAGAATGGTAAAAAA
GAAAGTTTAGAATCGATCGCCATCATCATCTTCTTCTTCTTCATCATCGTCATCTTCTTC
CCTCGGATTGAGTTTAGAAGTATGGGATCCTCCCTATAGTGAGACTTATTACTCACCCCC
TTATGGAGTTTCACTTATTAATATATTTGAAAACCGCAAATGATGGAAGTGTTAATATAT
ATGGAAAAGAAGAGGAGGCTAAAAAAAAAAGTATACAGGAGGATTAAAAAAGCATATTTT
TTTCCCCCCCCCCTGCTGTAAATAAACATAGAAGAAAAAAAGAAGAAGCAAAGTTAGTAA
TATACGA
GenBank Accession CR396548 [GenBank]
Graphic View Graphic view of gene At1g15690
Predicted Position of Insertion Chr1:5402429 - go to primer design
BLAST e Value 6e-54
Hit Clone Code (BAC ID) F7H2
Hit Gene Code At1g15690 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Inorganic H pyrophosphatase family protein
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At5g05690

 
Sequence (A. th genome BLAST matches underlined)
>26-K017219-022-377-B04-8409
ATTCCGGACATGAGCATTTACTATTGATATATCCTACCATGAGTATATGATCATGTGTTT
CCGGCGAAATTCACAGCCTTTCCGGCGAGCTACATCATGCTCAGTCACTCTCGACCCTCA
GGTAAACTCTAAAGATCTTCTTCCTACCTATGGGATCTCCCCTATAGTGAGAATGGNTGA
GCCTATGGGATCCTCCCTATAGTGAGACCTTTCCTTGAAGAAGTAAGAGATGGGAAGAAG
TAGTTGGGGGAAAAATAAAATTTACGGTGAAAGAAAGAAATGGGACAGAGACTACGACAA
TGGGAGCATAATGATATGGGCATGATGGCCTCTAAATGTCTCCATCATTTACGTTTCACA
CTGGTGCCTATGGGATCCTCCCTATAGTGAGAATTNTAATTTCCCGGTCATTTTCCTTCT
ACTTTGCCTCCATTTGTTCTCAGCTCGGTGTTTCTCTGTGAACGAAACTAATCTGGGTAG
TGTATTGAAGAGCCTCTTCTTCTTCCTATTACTTCATCTAAGCTGTCTCCTGGATCTA
GenBank Accession CT026308 [GenBank]
Graphic View Graphic view of gene At5g05690
Predicted Position of Insertion Chr5:1705136 - go to primer design
BLAST e Value 8e-61
Hit Clone Code (BAC ID) MJJ3
Hit Gene Code At5g05690 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Cytochrome P450 superfamily protein
Insertion Classification CDSi
Confirmation Status failed, line belongs to a contamination group, please check line 038B01

Gene hit At4g21326

 
Sequence (A. th genome BLAST matches underlined)
>26-K017229-022-377-B04-8409
TCCGGCGATATGCGCAGCCTTTCCGGCGAGTTACTTCATGCTGCAGTTTCGCTCAATCCT
GCAAGTATAGCTCTAAAGAACTGCTTCCTAGTCGTGGAATCTCCACATATCTGAAGAGAC
TCGAAAGAGATTACTGCAAATGTTGGCTTATTCTTCTCGCTCGTCGATCATCATTAACCT
AAGCTTCTCTATTTCCTCTCTATCTTTTTTCTCTATTTTCCTTTTTGTTATTGAAATAAT
TGCGAACGTAACCTAAATTTCGAGGTATCTAATTTGAGATCTTGTTAATAGTTCGAAATT
AAACCCTAATTTTGTTGTTGCTATGCAT
GenBank Accession CR770360 [GenBank]
Graphic View Graphic view of gene At4g21326
Predicted Position of Insertion Chr4:11345898 - go to primer design
BLAST e Value 1e-47
Hit Clone Code (BAC ID) T6K22
Hit Gene Code At4g21326 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation subtilase 3.12
Insertion Classification TS2TE (5')
Confirmation Status failed, line belongs to a contamination group, please check line 255F07


Last Updated on 07.07.2016 14:03