Line specific information

Line ID 377E01
Vector Used pAC161
Line Availability available from GABI-Kat
Segregation Analysis unknown

Gene hit At3g16180

Sequence (A. th genome BLAST matches underlined)
>05-K026822-022-377-E01-8409
AACTAGATTTTAAGGAATTAATACTGATATTAGAGAGGGTATGATTATTTAAGACCTGTT
ATTATAAGAGGTCACAGGGACGTTTCAGAACGCCTGGCTGCGAAT
GenBank Accession CR396613 [GenBank]
Graphic View Graphic view of gene At3g16180
T-DNA Border not detected
BLAST e Value 1e-17
Hit Clone Code (BAC ID) MSL1
Hit Gene Code At3g16180 [TAIR] [MIPS] [SIGnAL]
Gene Annotation proton-dependent oligopeptide transport (POT) family protein
Insertion Classification CDSi
Confirmation Status unknown

Genome hit T23K23

Sequence (A. th genome BLAST matches underlined)
>05-K017219-022-377-E01-8409
GTCCTAAGATTTACAGAAGTCCAGACCTATGGGATCC
GenBank Accession BX004112 [GenBank]
Graphic View Graphic view of sequence BX004112 of line 377E01
T-DNA Border 341 base(s) before start of sequence
BLAST e Value 2e-06
Hit Clone Code (BAC ID) T23K23
Hit Gene Code  
Gene Annotation  
Insertion Classification  
Confirmation Status unknown