SimpleSearch - Line and FST details


Line specific information

 
Line ID 377E12
Vector Used pAC161
Line Availability only available from NASC (N436156)
Segregation Analysis 50:48:35
Confirmed for Hit At2g23070 At3g29035
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g23070

 
Sequence (A. th genome BLAST matches underlined)
>93-K017229-022-377-E12-8409
ATTTGCTTTATTCCTCTCCTCTCTTTTTCTCTGGCTTCTCTTCGAATACGATGCCCTCTC
CACTATTCCGCCCGGTTATATCGTGATAGAAATCAACCCCATCGCGCTTGTCTCCAGGAC
CATCGTGCGTGAATCCGCATCCATTCGCTTCACGTGAGCGTCTGCGTATCCGAGATTCTT
CTTCAACCCTTCTCTAATCCCGCACAACGCACTTCGTCTGAATGACTCTCACACTCTGCG
CTTTGAAGATCACCTGATCATTCCAGAGAGCATGGGCATCGCCAATTTCTCCTTTTCCTC
CTCCTAAGATAGATGTCGAAAGCTATGGGAT
GenBank Accession FR809115 [GenBank]
Graphic View Graphic view of gene At2g23070
Predicted Position of Insertion Chr2:9826907 - go to primer design
BLAST e Value 1e-10
Hit Clone Code (BAC ID) F21P24
Hit Gene Code At2g23070 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Protein kinase superfamily protein
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At3g29035

 
Sequence (A. th genome BLAST matches underlined)
>93-K017219-022-377-E12-8409
GTTATAAGATCTATTAGTGTCATCTTTGTATATCCTATGGGATCGTTCATATAGTGAGAT
GCTGAATTGTGTTTGCATATTCTCATTATTTCCCTGTTTGTAATTAATGATTGTAACATA
CCTAAGTAGATAATATTAGATTAAAAATATGACTATGGGATCCTCCCTATAGTGAG
GenBank Accession BX004127 [GenBank]
Graphic View Graphic view of gene At3g29035
Predicted Position of Insertion Chr3:11035185 - go to primer design
BLAST e Value 1e-47
Hit Clone Code (BAC ID) MRI12
Hit Gene Code At3g29035 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation NAC domain containing protein 3
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR396619 [GenBank]


Last Updated on 31.08.2016 09:40