Line specific information

Line ID 379D12
Vector Used pAC161
Line Availability available from GABI-Kat
Segregation Analysis unknown

Genome hit K1F13

Sequence (A. th genome BLAST matches underlined)
>92-K017221-022-379-D12-8409
AATTTATTGTCTTTTTATGCTATTTAAGAACCAAGAAGAAAAACTTTAAGCCCTCTATCT
ATCTATGATGAATGAAGCATGCCAATAGGCACATAAATAATCTAACACTA
GenBank Accession BX004351 [GenBank]
Graphic View Graphic view of sequence BX004351 of line 379D12
T-DNA Border 75 base(s) before start of sequence
BLAST e Value 1e-39
Hit Clone Code (BAC ID) K1F13
Hit Gene Code  
Gene Annotation  
Insertion Classification  
Confirmation Status unknown
Other FSTs Supporting this Hit BX004352