SimpleSearch - Line and FST details


Line specific information

 
Line ID 379F02
Vector Used pAC161
Line Availability only available from NASC (N436350)
Segregation Analysis 50:50:32
Confirmed for Hit At5g05410
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g05410

 
Sequence (A. th genome BLAST matches underlined)
>16-K035333-022-379-F02C-8409
TGAGCCATTTACAATTGCATGTAGAACACAAATTGATACATCGAGGAAAAGGAAATCTAG
AAGTAGAGGTGACGGTACTACTGTGGCTGAGAGATTAAAGAGATGGAAAGAGTATAACGA
GACCGTAGAAGAAGTTTCTACCAAGAAGAGGAAAGTACCTGCGAAAGGGTCGAAGAAGGG
TTGTATGAAAGGTAAAGGAGGACCAGAGAATAGCCGATGTAGTTTCAGAGGAGTTAGGCA
AAGGATTTGGGGTAAATGGGTTGCTGAGATCAGAGAGCCTAATCGAGGTAGCAGGCTTTG
GCTTGGTACTTTCCCTACTGCTCAAGAA
GenBank Accession HG968939 [GenBank]
Graphic View Graphic view of gene At5g05410
Predicted Position of Insertion Chr5:1602683 - go to primer design
BLAST e Value 7e-173
Hit Clone Code (BAC ID) K18I23
Hit Gene Code At5g05410 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation DRE-binding protein 2A
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX004366 [GenBank]

Gene hit At5g29975

 
Sequence (A. th genome BLAST matches underlined)
>14-K017231-022-379-F02-8409
AAGAGAAAGAAGCCTATTTCGAGGAAAGAAGAATTGAGTATTCTGCAACTCATCTCTCAA
GAGAGGATGCTGAATATGATGATGAGATTAGAGAGGACTATGCAGACCCTCTCTATCACC
CATTTTCTTCTTAATGAGTGTGAGGAGTCAAGCTATGGGATCCTCCTTATAGTGAGANAG
NCTCTTCCTTCGAGTTGATAAATCGCTTTCGAGTTTACCCTTCTTGCTCGTATCTTTTCT
TCTTCTTCTTGCGCGTAGCTCTTTCGAGATTTCCTCTTCTTTTTATCAGACAGCTTTAGC
AGAAATCAGAATATCTAAGGAAGACAAAGTATCTACGGAGTATTTATAGCCTTCTCTATG
GGATCCTCCCTATACGGAGAGCNTTTCCGCAAGTCCTGTAAAGGCCTCTATGTACAACTT
GTGAA
GenBank Accession BX004367 [GenBank]
Graphic View Graphic view of gene At5g29975
Predicted Position of Insertion Chr5:11327427 - go to primer design
BLAST e Value 2e-82
Hit Clone Code (BAC ID) T3P01
Hit Gene Code At5g29975 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation transposable element gene
Insertion Classification TS2TE
Confirmation Status unknown


Last Updated on 07.07.2016 14:03