SimpleSearch - Line and FST details


Line specific information

 
Line ID 381F11
Vector Used pAC161
Line Availability only available from NASC (N436551)
Segregation Analysis 50:44:30
Confirmed for Hit At3g15950
Parent of DUPLO pair 2818
Parent of pair(s) none

Gene hit At3g15950

 
Sequence (A. th genome BLAST matches underlined)
>86-K017268-022-381-F11-8409
TGATCTGTNATTTCCCGGACATGAAGCCATTTACTATTGAATCTCGTGCAGAATCATGAT
CTTCCTTTAGCCTCCACTATCATTTTCAAGTAGACATAAACTACTCCTTCATCTTATAGC
CCTAGTACTATGGAAAGCGTACCTCCATTGCGATGAGAGCATCCATATTTCGTAGATTCG
TCGTCTCCTTCAGCTTTGTTATCGGCGATATCTTCAAGTTGTTTAAAACTCTCGGTAACG
GCTGCAAGAGAGAAAAAAAAAACTCTTAAAACTTCTTTGAACAATAAAAAGTTAAAAATT
CTCTCTGCATATGATGATTGGAATGTCAATTTACCTTCAAACTCACGTTCAATTGCATCT
ATGGGATC
GenBank Accession BX004625 [GenBank]
Graphic View Graphic view of gene At3g15950
Predicted Position of Insertion Chr3:5400076 - go to primer design
BLAST e Value 5e-71
Hit Clone Code (BAC ID) MVC8
Hit Gene Code At3g15950 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation DNA topoisomerase-like protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX004625 [GenBank]


Last Updated on 31.08.2016 09:40