SimpleSearch - Line and FST details


Line specific information

 
Line ID 382E01
Vector Used pAC161
Line Availability only available from NASC (N436625)
Segregation Analysis 100:96:83
Confirmed for Hit At1g48000
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit F25P12

 
Sequence (A. th genome BLAST matches underlined)
>05-K017269-022-382-E01-8409
ATTTCCCGGACTGAAGCCTTTACATTGAATATATTCTATGGGATCCTCCCTATGGTGAGA
CATGTAGATTTACATGTAGTTTTTCGTGTCACCTAATTGATTGTAGTCGACTATGCAAAT
TTTTCTCTTTTCGATTGGGTTTAGATTACTCATACCGCCCTAAGAAATCGACTAAAGAGT
TGATTTTCGAAAAACTTTTATCGATACCTATGGCTGGTTTGAGGCTTATTAGTTTCAACG
AGACTTGTGATGATGGTTAATGTTTGGAATGTTTAAACTTTGAACTTATGTTTATTTAGT
TTTGAAGAGATTTATGATGATAAAAACAATGATCTATTTCATAAATTATAATTCTAAAAA
ATTTCATTCAAAAGATTTCTCTAAATTTGATTTTTTTTTTGACCGGGCATGTTAATTAAT
TAAAGGGAGAAATATATTGTACTTGAACTTGAACCTTGAGATGGCGGTTGAAATACAATT
GTTTCAAACTTTATTTCTTTTGGTTATAAGTTGTTTATGGATTTTTTCTTTATTCTTCCG
AAAAATTTTTTTTTTTCCTTTTAAA
GenBank Accession BX285387 [GenBank]
Graphic View Graphic view of sequence BX285387 of line 382E01
Predicted Position of Insertion Chr1:21316371 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F25P12
Insertion Classification Genome Hit
Confirmation Status unknown

Gene hit At1g48000

 
Sequence (A. th genome BLAST matches underlined)
>05-K017265-022-382-E01-8409
TGATCTGTAGATTTCCCGGACATGAAGCCATTTACAATTGAATGGATGACATAACGAGAC
ATCCCAATCATTATACCACGCATGTTTTCCTTTTCTCATACCGTCATACGAGATGAGCCA
TACCTATGTGAATGTGATTATATCGAGCTATGAGAATACTTTTCTTATGGCTGTGACTTC
TCCATGACGGCATAATTTAAATTCCTCTGTAGAATTGGTAAAGTAAGAAAGAACAAGTTG
ACATATTCATAGTTCATTATTATCATTAAAAGTGTACTTTCGTATGAAACAGTTTGGTCG
GTCCAAATTTATTTATTTTTTCCTTTGGAGTTCTTTTCATATTAGCCTTTTGAGTGTGGA
ACTCAAACACCTTTCCCAACCATCCAATTCCATACAGCCTCATGGAATTGTTATCTTTAT
TGATTTGGGAAATTGCACTATGGGATCCCCCTAATAGTGAG
GenBank Accession CR770370 [GenBank]
Graphic View Graphic view of gene At1g48000
Predicted Position of Insertion Chr1:17705820 - go to primer design
BLAST e Value 7e-160
Hit Clone Code (BAC ID) T2J15
Hit Gene Code At1g48000 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation myb domain protein 112
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03