SimpleSearch - Line and FST details


Line specific information

 
Line ID 382H01
Vector Used pAC161
Line Availability only available from NASC (N436661)
Segregation Analysis 60:60:52
Confirmed for Hit At3g54250
Parent of DUPLO pair 1361
Parent of pair(s) none

Gene hit At3g54250

 
Sequence (A. th genome BLAST matches underlined)
>08-K017265-022-382-H01-8409
TTTCCCGGACATGAGCATTATACGATCTCTTGATCCTGATATCTCTGCACAGTCACCAGC
TGGTGCCGTTAGTCCTGCTTTTGATCGGGATCGAATGTGGCTCATTGGCAAGGTACACTC
GCTTCATTTCCCATCACGATCTCTCTCCTTTTGCTGAGATTCCAATTATCGAATTACAAA
GATTTTTGTTGATGATGTTGTTTCATGTTAGTGTAGGAAATATCTCTTTCTGGAAGTACG
TACCAAAATTGCTTGGAGGGAAATACGAGGTCGTGCTGGTGATGTTGAAGACATGGAAAA
GGGGATCAAGATAAGGAAGAAAGATTGGGAGAAATTGAATCTACATATTGCTTCTCATAA
TAACTTCCCTACTGCTGCTGGCTTAGCATCTTCAGCTGCTGGATTTGCTTGCCTATGGGA
GenBank Accession BX285440 [GenBank]
Graphic View Graphic view of gene At3g54250
Predicted Position of Insertion Chr3:20084564 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F24B22
Hit Gene Code At3g54250 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation GHMP kinase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX285441 [GenBank]


Last Updated on 07.07.2016 14:03