SimpleSearch - Line and FST details


Line specific information

 
Line ID 383B01
Vector Used pAC161
Line Availability only available from NASC (N436685)
Segregation Analysis 50:50:37
Confirmed for Hit At2g36970
Parent of DUPLO pair none
Parent of pair(s) 9589

Gene hit At2g36970

 
Sequence (A. th genome BLAST matches underlined)
>02-K017270-022-383-B01-8409
TTATCATGAGATTTCCCGGACATGAAGCATTTATCAACCAATATACGTGTCGAAGATCCA
ATAGTCGCAACCGCGTCTATGAGAAGAGGGTTAACCGTTTCAACATTGTTTCTTAACTCA
CTTGAAGTTTCTCCATTCATCAATCTTTTAACATTCGACTGAGACTTGGTCCCTTGTGAT
TGTCTTCTTACTCACAAAGATTAATCCCAATGCACCAATCATCGCACCACAAGCTTCCTA
TTCGTGAACTGATCTGTCAAAAGTGGATAACACAACAAAGGCAAACCACACCAAACGCTC
TCTATGGGATCCTCCCTTATAGTGAGANAANACNTCNNNTTGCAANTCCTANTGACTGCA
CCAAAATGAGCTATGGGATCCTCCCTATAAAGAGACTCTGAAAGATCGACACGCTTGCTC
GAATGCTACATCGGAANGTGAGAAACNCAGCTCAAGGATATGGAGTTACACCGACCTGAC
CTCCACTTCCGATTCGATAATCCAGCCCTGGCTATGCGACCCTCCCCATGGCGAGAGGTA
TATGATGACTCTAATGAGTTGCCCAAAAGTCTGTTTTGGGTCAACTTACTTCAAAAATTG
CGTCTTTGGCAAAATCGGGTCGCATAGCAAGGGCCCCTCAGG
GenBank Accession BX285479 [GenBank]
Graphic View Graphic view of gene At2g36970
Predicted Position of Insertion Chr2:15530616 - go to primer design
BLAST e Value 8e-101
Hit Clone Code (BAC ID) T1J8
Hit Gene Code At2g36970 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation UDP-Glycosyltransferase superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX285478 [GenBank]


Last Updated on 07.07.2016 14:03