SimpleSearch - Line and FST details


Line specific information

 
Line ID 383G09
Vector Used pAC161
Line Availability only available from NASC (N436753)
Segregation Analysis 50:48:34
Confirmed for Hit At2g05171
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g05171

 
Sequence (A. th genome BLAST matches underlined)
>71-K017266-022-383-G09-8409
TTTCCCGGACTGAAGCCTTTACTGTATATTATTGTAGGTTATGGTTTTATACTCATCATT
GAATCTAAAAACAAGGGAGAATCTCTTTTGTGCGAGTAGACAGATACTAAAGTTAAGATA
CTTGAACCGTTTCAGGAATTTGTATTCGTCGTCATCAGGGAGGTACAATAAGTTCGTCTT
GTCAGATTCGCAGGGCTGAATCTCTGTGGGCTACTACTTCTAATCTCTGTAGTGCTTCCA
GTTTCCCTGAGGATGTTAACCGAATCAAAGTAAACCCGGAAGATTGATCTGATGACCCTA
TGGGATCCTCCTTATAGTGAG
GenBank Accession BX285571 [GenBank]
Graphic View Graphic view of gene At2g05171
Predicted Position of Insertion Chr2:1874822 - go to primer design
BLAST e Value 9e-144
Hit Clone Code (BAC ID) F5G3
Hit Gene Code At2g05171 [TAIR] [MIPS] [SIGnAL]
Gene Annotation pseudogene
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23