SimpleSearch - Line and FST details


Line specific information

 
Line ID 384G11
Vector Used pAC161
Line Availability only available from NASC (N436851)
Segregation Analysis 50:49:29
Confirmed for Hit At4g38000
Parent of DUPLO pair none
Parent of pair(s) none
Note Although the line exists, the insertion in At1g20880 can not be ordered because the confirmation of this insertion failed.

Gene hit At4g38000

 
Sequence (A. th genome BLAST matches underlined)
>87-K017271-022-384-G11-8409
ATTTCCCGGACTGAAGCATTTATCACACCAACAAACGGGACGTCATCGGCGTTTTCCGAG
CTTGTAAGAAACATCCATCGACGGCAATGATGATGATGAGTTCTGGTGGATTCTCCGGCT
ATATGTTTCCGATGGATCCTAACTTCAGCCTTGCCTCGTCTTCTATCGAGTCTTTGAGTT
CTTTTAACCAAGATTGGCACCAGAAGCTGCAGCAACAAAGACTCCGTCACTTCCATGTTT
CTCCAAGATTCTCTTCCGGTTAACGAGAAAACGGTTATGTTTCAGAACGTAGAGTTGATT
CCTCCTTCGACGGTGACGACGGATTGGGTTTTCGATAGGTTCGCCACTGGAGGAGGTGCA
ACAAGTGGCAATCATGAAGATAATGATGATGGGGAGGGTAATTTGGGAAATTGGTTCCAT
AATGCTAATAATAATGCTCTGCTCTAATTATCAATTATCATTTACTCTCTATTTCTCTAA
ATATTGTAGCTATG
GenBank Accession BX285703 [GenBank]
Graphic View Graphic view of gene At4g38000
Predicted Position of Insertion Chr4:17858763 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F20D10
Hit Gene Code At4g38000 [TAIR] [MIPS] [SIGnAL]
Gene Annotation DNA binding with one finger 4.7
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At1g20880

 
Sequence (A. th genome BLAST matches underlined)
>87-K017267-022-384-G11-8409
GTCACTTACGACAGCAGCAGCGGATAGCCGCTATCGACATCGGAGAGCACGCCGAACGCG
GTTACCTATGGGATCCTGCTTATAGTGAGAGNAACTANNATGTGTAAAACCGGAGTTCTA
ATTTTCCACCCTGAGTTTGATGATAATTAATGTATTAGACTGGTCCGTAATCTTAGGATG
AAACAAAGCTCTACTCTGTGATACCCCCTATATCGAGAGTATCACCATATTGATCGAAAT
GCCGACGAAGAGTCTCGCTTTGAGTCTCCCAGGCAAGGCCACCAACAAAGACTTTAGTAA
AGGTTGTGTCACCAAAAGGAGAATTCAAGTAATGAAACCCAGAGCTCGGAATCGAATGAT
ACGCCATGGATTAGAACCAAAGACGGAAACTTTGATGAAGTATGGATAGAGACAGATCCT
AAGACTTGACCCGGTAAACCCTATGGGATCCTCCCTATAGTGAG
GenBank Accession BX285702 [GenBank]
Graphic View Graphic view of gene At1g20880
Predicted Position of Insertion Chr1:7264502 - go to primer design
BLAST e Value 2e-123
Hit Clone Code (BAC ID) F9H16
Hit Gene Code At1g20880 [TAIR] [MIPS] [SIGnAL]
Gene Annotation RNA-binding (RRM/RBD/RNP motifs) family protein
Insertion Classification CDSi
Confirmation Status failed, line belongs to a contamination group, please check line 643A05


Last Updated on 14.10.2014 10:23