SimpleSearch - Line and FST details


Line specific information

 
Line ID 385F02
Vector Used pAC161
Line Availability only available from NASC (N436926)
Segregation Analysis 100:99:96
Confirmed for Hit At4g23160 At2g28170
Parent of DUPLO pair none
Parent of pair(s) 13178, 69831, 69832, 69833

Gene hit At4g23160

 
Sequence (A. th genome BLAST matches underlined)
>14-K018252-022-385-F02-8409
TGATCTGTAATTTCCCGGACATGAAGCCTTTACATTGAAAATGTATTCTCTCTGATTTGG
ACACCGAGTTAACGATTCGTTAACGGAGAAGGCAACGCAGTTACTGCAAACTTCCGGGGA
TAGGTCTCCGCGACAAAGGAAAAGTCCGGTGACCCTGTCGGGGGTTTGTCCCGCCCTGAT
GTTTTGGAATCCGGTGGAGTAAGAGGCGTTGCGGGAAGCACAAGAGGACAAAAGGGTTTT
GAGATTGGTGGAGTAAGTGCTGTTACTTGAGTAAGTTGTCCTATTTGGACAATCATGATT
TAGGTAAAAAGGATTTTGAGCAGAAGCTTTGAAGCTATGGG
GenBank Accession BX285795 [GenBank]
Graphic View Graphic view of gene At4g23160
Predicted Position of Insertion Chr4:12131797 - go to primer design
BLAST e Value 1e-161
Hit Clone Code (BAC ID) F21P8
Hit Gene Code At4g23160 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation cysteine-rich RLK (RECEPTOR-like protein kinase) 8
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At2g28170

 
Sequence (A. th genome BLAST matches underlined)
>14-K018248-022-385-F02-8409
TATCAAGNAGACACCAGAAGGCAGGCTGGTTAAAGATGTCTACATTTACTTGGTTATGGC
TACCGCATATTTTGTTTACATGTTTTGGCTTAATTTCTTTCAATTCTCAACATATGGCTG
GTTTATTATCGGTTTGGCTACCCCGGCTGGGCCTCCACTCGGATCGGCTCTCATTCAAAG
ATTTGAATGCTTTACCGTTGGCGTTCTGTTGCCGCTCTTTGGATCTCTTAGCATGGAACA
ACTA
GenBank Accession BX285794 [GenBank]
Graphic View Graphic view of gene At2g28170
Predicted Position of Insertion Chr2:12008982 - go to primer design
BLAST e Value 4e-124
Hit Clone Code (BAC ID) F24D13
Hit Gene Code At2g28170 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Cation/hydrogen exchanger family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03