SimpleSearch - Line and FST details


Line specific information

 
Line ID 386A08
Vector Used pAC161
Line Availability only available from NASC (N436968)
Segregation Analysis 50:50:46
Confirmed for Hit At2g34470
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g34470

Sequence (A. th genome BLAST matches underlined)
>57-K018253-022-386-A08-8409
TGATCTGANATTTCCCGGACATGAAGCCTTTACATTGAATATAGATTTACGGATTTGGGT
TTCATTTACATGTAGATCGTGAGTATTATTATCAGTGGCAAACACAAGATTGTTTTCTCG
ATCTCACTCATGTGACTAAATAAGATTTTGATATTGTAAACGTTGTAGGTGACAAATGAT
ATATTCACGAAAGAGGATGGTGAGTTTCTGGTGAAGAATGGGGCTCTTCCTGAGGAAAGG
ATTAGAGCTGTTGAAACAGGTGGATGTCCACACGCTGCTATCCGTGAAGATATCAGTATC
AATTTGGGTCCTCTTGAGGAGTTATCTAACTTATTCAAGGCTGATTTGCTTCTTTGTGAA
TCCGGTGGAGGTGAGGTTTCATTTCTAGCTATGGGATC
GenBank Accession BX285848 [GenBank]
Graphic View Graphic view of gene At2g34470
Predicted Position of Insertion Chr2:14531817 - go to primer design
BLAST e Value 1e-176
Hit Clone Code (BAC ID) F13P17
Hit Gene Code At2g34470 [TAIR] [MIPS] [SIGnAL]
Gene Annotation urease accessory protein G
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Related paper(s) [Witte et al. 2005, ureG-2]

Gene hit At5g42240

 
Sequence (A. th genome BLAST matches underlined)
>57-K018249w-022-386-A08-8409
TGATCTGTNATTTCCCGGACATGAAGCCATTTCTACCTATTATGATCATGTTGGTCTGCA
ACTATGTCACCGTAGAGTTTATCGGCCCACTGACGATCACTATTACAATGAGTAGTAACA
CTATATACTTGAAACAGTGACCCATTGGGCTTAAACCGCAGCTTTTTGAATCAGTGGATT
TTTTACTTAAAAAGAGGAGTTCTCATACACACTTCGAATAACGTCCCTGCGATCGCTTGC
GGTGGGAAGTTTCTTTCTCCCTAAGGGATCCCCCATATAGTGAGAAGTGGATATTCTTTA
TGTCTCTGTCCTCTAAGAGTAAGATCTAAGTTCTACCACGGTTCATAAATCAGCTAATTG
GTTATGAGAACCCAAACCCAGAACTTTAACCAGTAAAGCATGAATCTTTGAGATACCCAT
TAAACAAAATCTACCAGAGCAACTTGAGCACAAGGTACCTAAGATTACCAAATTGGAAGA
CAATATCACAACCCATAAGACTCTAGTCTACTCTTATCTTCTTCAATTCGATCTTGGGAG
TGAAAACCAGTGACGCGCCTGCTTCTTCTTGGTTAAGTCCGCTTCGGTTCATATCGGTTC
GGTTCAATTTACTCTAAGGTGTCTCTCTTTCATAATTTTGATTACCACCACTTTAAGGAG
TTTGGCCGGAACCAACGTCAAAATCCGATGCCGTCACGATATTAGAAAATCGGAAAACCC
TGCCCATGCATATCACAAGATCGCTGCTGGCTCATACAAACTGGGCTGAGTGCCCGGAAA
TTAAATTTCGGGGGGCTCCATACCCTCCGGTTCCGGGGCCGCAACCCAATATTTTAAAAA
TTTCGACCAATAAAACCGATTTCCGTCTTC
GenBank Accession BX285847 [GenBank]
Graphic View Graphic view of gene At5g42240
Predicted Position of Insertion Chr5:16888689 - go to primer design
BLAST e Value 4e-152
Hit Clone Code (BAC ID) K5J14
Hit Gene Code At5g42240 [TAIR] [MIPS] [SIGnAL]
Gene Annotation serine carboxypeptidase-like 42
Insertion Classification TS2TE (5')
Confirmation Status unknown


Last Updated on 14.10.2014 10:23