SimpleSearch - Line and FST details


Line specific information

 
Line ID 386G09
Vector Used pAC161
Line Availability only available from NASC (N437041)
Segregation Analysis 50:48:47
Confirmed for Hit At3g57130
Parent of DUPLO pair 12404
Parent of pair(s) none

Gene hit At3g57130

 
Sequence (A. th genome BLAST matches underlined)
>71-K018253-022-386-G09-8409
TGATCTGTGGATTTCCCGGACATGAAGCCATTTACATTGATATATTCACAGAGCTCGACA
TCGGAGGAGTCCAATGCACGTCTCATGCCTCCTGATCTTCTGGTCTTCGAGGTCTAAATG
TCGATGCGTTAGGTCATGGTGGTTGCACGGCGTTATGTGAACGGAGAGGCATTGAAGATT
TGAGACGGAGCTCCTGCACTACTTGGCTACAGTTCGATTGATAGATGTGTTGGCTATGGG
AT
GenBank Accession BX285938 [GenBank]
Graphic View Graphic view of gene At3g57130
Predicted Position of Insertion Chr3:21149411 - go to primer design
BLAST e Value 1e-34
Hit Clone Code (BAC ID) F24I3
Hit Gene Code At3g57130 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Ankyrin repeat family protein / BTB/POZ domain-containing protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit F5K7

 
Sequence (A. th genome BLAST matches underlined)
>71-K018249w-022-386-G09-8409
GACTCAATCTAGATGAGTCCTATGGGATCCTTCATATAGTGAGAGTAATAACAATGTACT
CTTTGGAGGAAAACACTTTTGTCTATCCCTATGGGATCCTCCCTATAGTGAGAAATAATG
ATATTAATATTGAATTAAATACCTATATGTCACTATTGGATGCTCCCAATCTTCTGAACA
TTAATGGCGGTTCTGGAAACACGACCATCGCCACGCACCTATAAGATCCTCAGTGGGGGG
TGATATAAAAAACTTCACATTTTATTCCTTTATTTCGCAATGTGAAAAGATAATTTTTTT
TTTAGGAACGAAAACGCCAAAAATCAAAAAGAAATGGTAAATGTAACATAAACAACCCTG
CAAAACAAAAGAGAGGATATAACGGAAAGTTAAAGGGAACAAATAGGGGGATTATATAAT
AAGGGGCCAACATACGGCCGACATGTAATAACACTCAGGGACAAATGGAACCAATGCGCA
ACAATCAAATAGAAAGAACAACAAGATTTACGGCGCGATACGAGGGACACGGAGGCGGAA
ATGGGACAAGGGTGCCACAATAATATATGAGAGGGGGCGCCGCACAGAACACCGGGAAAT
TGAACGTGACGGGTGGAGTAACAGGAAGAAGGTGAAACAACA
GenBank Accession BX285937 [GenBank]
Graphic View Graphic view of sequence BX285937 of line 386G09
Predicted Position of Insertion Chr2:2347100 - go to primer design
BLAST e Value 2e-06
Hit Clone Code (BAC ID) F5K7
Insertion Classification Genome Hit
Confirmation Status unknown


Last Updated on 14.10.2014 10:23