SimpleSearch - Line and FST details


Line specific information

 
Line ID 387F09
Vector Used pAC161
Line Availability only available from NASC (N437125)
Segregation Analysis 50:50:46
Confirmed for Hit At3g55320
Parent of DUPLO pair 2272
Parent of pair(s) none

Gene hit At3g55320

 
Sequence (A. th genome BLAST matches underlined)
>70-K018250-022-387-F09-8409
TATCCTGAAATTTCCCGGACTGAAGCCATTTACAATTGGTAATTGATTTCTCCACCATTT
GCCCTTCCATTGTGAACAAAGAATCGTCCAATCCAAAGTTGCAGCGCACACGAGCATATA
GCAAGCCCATAAGTAAATCCAAGTCCAAGGCCTTGCACAAGACTAATTAATATGCCGTAT
CTCAGGGTTGCTTGAAGGGAGGTTGCATATGAATATTTTGCTAGAGTTTCATTTGTAAAG
GCATATAAAGTCCTAATGTAAGAGATCGCCTGCACATTTAAGATAAATCTTTCTAAGAAT
TAGAATATTGACACCAGACTCTAACTGAGGCAATAAACTAGTGTCGGAAGGGAGCACTAG
AAAATGGGATCTATAGGGTACACATTACAAAACCACTTGTAATCATGCATAGACTATCGA
GTGTGGTTACTAGGCATTCCCAGTGATGTACATCCTATGGGATCCTCCCAAATGGCTATG
CACTTGGTCTACATTTTGAGATGAAACTGGCAGAAGTTTAACTGATTCTTGATCACAATA
AAACCTCATTGTATCTAGTGAAGTAACCTA
GenBank Accession BX286014 [GenBank]
Graphic View Graphic view of gene At3g55320
Predicted Position of Insertion Chr3:20511364 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T26I12
Hit Gene Code At3g55320 [TAIR] [MIPS] [SIGnAL]
Gene Annotation P-glycoprotein 20
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23